View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14368_low_19 (Length: 262)
Name: NF14368_low_19
Description: NF14368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14368_low_19 |
 |  |
|
| [»] chr7 (5 HSPs) |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
| [»] chr1 (3 HSPs) |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 15 - 262
Target Start/End: Complemental strand, 44605322 - 44605076
Alignment:
| Q |
15 |
catagggatcattgcattaattgtattaaatcaaccattaattaatattaatttgcgcataatggcactaattaatgacagaaaacagaaagnnnnnnnt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| | |
|
|
| T |
44605322 |
catagggatcattgcattaattgtattaaaccaaccattaattaatattaatttgcacataatggcactaattaatgacagaaaacagaaa-aaaaatat |
44605224 |
T |
 |
| Q |
115 |
attaaaccgggtgactctaaaaatcggtcgagtcaccggtttccaccggttttttccgagccacgccggttttaaccggttcaattgcacagccgatctg |
214 |
Q |
| |
|
||||||||||||||||||||||| ||| |||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44605223 |
attaaaccgggtgactctaaaaaccggcagagttatcggtttccaccggttttttccgagccacgccggttttaaccggttcaattgcacagccgatctg |
44605124 |
T |
 |
| Q |
215 |
attaacagttcgaaccggtcataccactggttcacggtccaaccggtc |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
44605123 |
attaacagttcgaaccggtcataccactggttcactgtccaaccggtc |
44605076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 164 - 262
Target Start/End: Complemental strand, 16216404 - 16216306
Alignment:
| Q |
164 |
ttttttccgagccacgccggttttaaccggttcaattgcacagccgatctgattaacagttcgaaccggtcataccactggttcacggtccaaccggtc |
262 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||||| |||||||||| ||||| ||||||||| | ||||| |||||||||| ||| ||||| |
|
|
| T |
16216404 |
tttttaccgagccaagccggttttaaccggttcaattgcatgaccgatctgataaacagctcgaaccgggtacaccaccggttcacggttcaatcggtc |
16216306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 158 - 232
Target Start/End: Original strand, 10198996 - 10199070
Alignment:
| Q |
158 |
caccggttttttccgagccacgccggttttaaccggttcaattgcacagccgatctgattaacagttcgaaccgg |
232 |
Q |
| |
|
||||||||||| |||||||| ||| ||||||||||||||||||||| |||||||||| || || ||||||||| |
|
|
| T |
10198996 |
caccggtttttaccgagccaagccagttttaaccggttcaattgcatgaccgatctgataaatagctcgaaccgg |
10199070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 147 - 261
Target Start/End: Original strand, 35332592 - 35332705
Alignment:
| Q |
147 |
tcaccggtttccaccggttttttccgagccacgccggttttaaccggttcaattgcacagccgatctgattaacagttcgaaccggtcataccactggtt |
246 |
Q |
| |
|
||||||||||||| || |||| || ||||||||||| ||||||||||||||||||||| |||| |||| |||| |||||||| | ||| ||| |||| |
|
|
| T |
35332592 |
tcaccggtttccatcgattttatc-gagccacgccgattttaaccggttcaattgcacgaacgatttgataaacaactcgaaccgattatatcaccggtt |
35332690 |
T |
 |
| Q |
247 |
cacggtccaaccggt |
261 |
Q |
| |
|
||| |||||||||| |
|
|
| T |
35332691 |
cacaatccaaccggt |
35332705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 143 - 260
Target Start/End: Original strand, 49033136 - 49033253
Alignment:
| Q |
143 |
cgagtcaccggtttccaccggttttttccgagccacgccggttttaaccggttcaattgcacagccgatctgattaacagttcgaaccggtcataccact |
242 |
Q |
| |
|
||||||||||||||||| | ||||| ||||| ||||||||| | || ||||||| |||||| ||||||| || ||| |||||||||||| || | |
|
|
| T |
49033136 |
cgagtcaccggtttccagcaatttttaccgagttacgccggttctgactggttcaactgcacaaccgatctaataggcagaccgaaccggtcatccctcc |
49033235 |
T |
 |
| Q |
243 |
ggttcacggtccaaccgg |
260 |
Q |
| |
|
||||| |||||| ||||| |
|
|
| T |
49033236 |
ggttcgcggtccgaccgg |
49033253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 15 - 262
Target Start/End: Complemental strand, 27194163 - 27193915
Alignment:
| Q |
15 |
catagggatcattgcattaattgtattaaatcaaccattaattaatattaatttgcgcataatggcactaattaatgacagaaaacagaa-agnnnnnnn |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||| | |
|
|
| T |
27194163 |
catagggatcattgcattaattgtattaaaccaaccattaattaatattaatttgcacataatggcactaactaatgacagaaaacagaagaaaaaaaat |
27194064 |
T |
 |
| Q |
114 |
tattaaaccgggtgactctaaaaatcggtcgagtcaccggtttccaccggttttttccgagccacgccggttttaaccggttcaattgcacagccgatct |
213 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
27194063 |
tattaaaccgggtgactctaaaaaccggccgagtcaccggtttccaccgattttttccgagccacgtcggttttaaccggttcaattgcacagccgatct |
27193964 |
T |
 |
| Q |
214 |
gattaacagttcgaaccggtcataccactggttcacggtccaaccggtc |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
27193963 |
gattaacagttcgaaccggtcataccactggttcgcggtccaaccggtc |
27193915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 158 - 262
Target Start/End: Complemental strand, 389084 - 388980
Alignment:
| Q |
158 |
caccggttttttccgagccacgccggttttaaccggttcaattgcacagccgatctgattaacagttcgaaccggtcataccactggttcacggtccaac |
257 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||| | ||||||||| ||||| ||||||||| ||||||| ||||||||||||||| |
|
|
| T |
389084 |
caccggtttttaccgagccaagccggttttaaccggttcaattgtatgaacgatctgataaacagctcgaaccgggtataccaccggttcacggtccaac |
388985 |
T |
 |
| Q |
258 |
cggtc |
262 |
Q |
| |
|
||||| |
|
|
| T |
388984 |
cggtc |
388980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 70; Significance: 1e-31; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 143 - 260
Target Start/End: Complemental strand, 1935925 - 1935808
Alignment:
| Q |
143 |
cgagtcaccggtttccaccggttttttccgagccacgccggttttaaccggttcaattgcacagccgatctgattaacagttcgaaccggtcataccact |
242 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| |||||||||| ||||| |||||| || | ||||| |
|
|
| T |
1935925 |
cgagtcaccggtttccaccggtttttaccgagccaagccggttttaaccggttcaattgcatgaccgatctgataaacagctcgaactgggtacaccacc |
1935826 |
T |
 |
| Q |
243 |
ggttcacggtccaaccgg |
260 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
1935825 |
ggttcacggtccaaccgg |
1935808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 158 - 262
Target Start/End: Complemental strand, 25232021 - 25231917
Alignment:
| Q |
158 |
caccggttttttccgagccacgccggttttaaccggttcaattgcacagccgatctgattaacagttcgaaccggtcataccactggttcacggtccaac |
257 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||||| ||| |||||| ||||| ||||||||| | ||||| ||||||||||||||| |
|
|
| T |
25232021 |
caccggtttttaccgagccaagccggttttaaccggttcaattgcatgaccgttctgataaacagctcgaaccggatacaccaccggttcacggtccaac |
25231922 |
T |
 |
| Q |
258 |
cggtc |
262 |
Q |
| |
|
||||| |
|
|
| T |
25231921 |
cggtc |
25231917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 158 - 262
Target Start/End: Original strand, 55676105 - 55676209
Alignment:
| Q |
158 |
caccggttttttccgagccacgccggttttaaccggttcaattgcacagccgatctgattaacagttcgaaccggtcataccactggttcacggtccaac |
257 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||||| | |||||||| ||||| | ||||||| | ||||| |||| |||||||||| |
|
|
| T |
55676105 |
caccggtttttaccgagccaagccggttttaaccggttcaattgcatgactgatctgataaacagcttgaaccggatacaccaccggtttacggtccaac |
55676204 |
T |
 |
| Q |
258 |
cggtc |
262 |
Q |
| |
|
||||| |
|
|
| T |
55676205 |
cggtc |
55676209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 134 - 228
Target Start/End: Complemental strand, 12704039 - 12703945
Alignment:
| Q |
134 |
aaaatcggtcgagtcaccggtttccaccggttttttccgagccacgccggttttaaccggttcaattgcacagccgatctgattaacagttcgaa |
228 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||| || ||||| || |||||||||||||||||||| | |||||||||| ||||| ||||| |
|
|
| T |
12704039 |
aaaatcggccgagtcatcggtttccaccggtttttaccaagccaaatcgattttaaccggttcaattgcataaccgatctgataaacagctcgaa |
12703945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 126 - 260
Target Start/End: Complemental strand, 13427591 - 13427457
Alignment:
| Q |
126 |
tgactctaaaaatcggtcgagtcaccggtttccaccggttttttccgagccacgccggttttaaccggttcaattgcacagccgatctgattaacagttc |
225 |
Q |
| |
|
||||||| |||| ||| | ||||||| |||||| || ||||| ||||||||| | | ||||||| || |||||||||| ||||||||| | | ||| || |
|
|
| T |
13427591 |
tgactctgaaaaccggccaagtcaccaatttccaacgatttttaccgagccacacagattttaactggatcaattgcactgccgatctggtaatcagctc |
13427492 |
T |
 |
| Q |
226 |
gaaccggtcataccactggttcacggtccaaccgg |
260 |
Q |
| |
|
||||||| ||||||| ||||||||||| |||||| |
|
|
| T |
13427491 |
aaaccggttataccaccggttcacggtcaaaccgg |
13427457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 61; Significance: 3e-26; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 134 - 262
Target Start/End: Complemental strand, 5384174 - 5384046
Alignment:
| Q |
134 |
aaaatcggtcgagtcaccggtttccaccggttttttccgagccacgccggttttaaccggttcaattgcacagccgatctgattaacagttcgaaccggt |
233 |
Q |
| |
|
|||| ||| ||||||||||||||||| |||||||| |||||||| ||||||||||||||||||||||||| || ||||||| ||||| |||||||| |
|
|
| T |
5384174 |
aaaaccggccgagtcaccggtttccatcggtttttaccgagccaagccggttttaaccggttcaattgcatgaccaatctgataaacagctcgaaccgag |
5384075 |
T |
 |
| Q |
234 |
cataccactggttcacggtccaaccggtc |
262 |
Q |
| |
|
| |||| |||||||||||||||||||| |
|
|
| T |
5384074 |
tacaccaacggttcacggtccaaccggtc |
5384046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 158 - 262
Target Start/End: Complemental strand, 37034286 - 37034182
Alignment:
| Q |
158 |
caccggttttttccgagccacgccggttttaaccggttcaattgcacagccgatctgattaacagttcgaaccggtcataccactggttcacggtccaac |
257 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||||| |||||||||| |||| || |||||| | ||||| |||| |||||||||| |
|
|
| T |
37034286 |
caccggtttttaccgagccaagccggttttaaccggttcaattgcatgaccgatctgataaacaactcaaaccggatacaccaccggtttacggtccaac |
37034187 |
T |
 |
| Q |
258 |
cggtc |
262 |
Q |
| |
|
||||| |
|
|
| T |
37034186 |
cggtc |
37034182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 159 - 212
Target Start/End: Original strand, 50324224 - 50324277
Alignment:
| Q |
159 |
accggttttttccgagccacgccggttttaaccggttcaattgcacagccgatc |
212 |
Q |
| |
|
||||||||| |||||||||| |||||||| |||||||||| ||||||||||||| |
|
|
| T |
50324224 |
accggttttatccgagccacaccggttttcaccggttcaagtgcacagccgatc |
50324277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 56; Significance: 3e-23; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 143 - 262
Target Start/End: Complemental strand, 52403795 - 52403676
Alignment:
| Q |
143 |
cgagtcaccggtttccaccggttttttccgagccacgccggttttaaccggttcaattgcacagccgatctgattaacagttcgaaccggtcataccact |
242 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||| |||| |||||||||||||||||||| |||||||||| ||||| | ||||||| | ||||| |
|
|
| T |
52403795 |
cgagtcatcggtttccaccggttttaaccgagccaagccgattttaaccggttcaattgcatgaccgatctgataaacagcttgaaccggatacaccacc |
52403696 |
T |
 |
| Q |
243 |
ggttcacggtccaaccggtc |
262 |
Q |
| |
|
|||||||||| ||||||||| |
|
|
| T |
52403695 |
ggttcacggttcaaccggtc |
52403676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 134 - 232
Target Start/End: Original strand, 45159222 - 45159320
Alignment:
| Q |
134 |
aaaatcggtcgagtcaccggtttccaccggttttttccgagccacgccggttttaaccggttcaattgcacagccgatctgattaacagttcgaaccgg |
232 |
Q |
| |
|
|||| ||| |||||||||| ||||||||||||||| || ||||| ||||||||||||||||||||||||| ||||| |||| ||||| ||||||||| |
|
|
| T |
45159222 |
aaaaccggccgagtcaccgatttccaccggtttttaccaagccaagccggttttaaccggttcaattgcatgaccgatatgataaacagctcgaaccgg |
45159320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 52; Significance: 7e-21; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 126 - 253
Target Start/End: Original strand, 39025244 - 39025371
Alignment:
| Q |
126 |
tgactctaaaaatcggtcgagtcaccggtttccaccggttttttccgagccacgccggttttaaccggttcaattgcacagccgatctgattaacagttc |
225 |
Q |
| |
|
|||||| ||||| ||| |||||||||||||||||||| ||||| |||||||| |||||| |||||| ||||||||| | ||||||||||||||| || |
|
|
| T |
39025244 |
tgactcaaaaaaccggccgagtcaccggtttccaccgatttttaccgagccaagccggtgttaaccagttcaattgtatgatcgatctgattaacagctc |
39025343 |
T |
 |
| Q |
226 |
gaaccggtcataccactggttcacggtc |
253 |
Q |
| |
|
||||||| | ||||| | ||||||||| |
|
|
| T |
39025344 |
gaaccggatacaccaccgattcacggtc |
39025371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 160 - 262
Target Start/End: Complemental strand, 31892549 - 31892447
Alignment:
| Q |
160 |
ccggttttttccgagccacgccggttttaaccggttcaattgcacagccgatctgattaacagttcgaaccggtcataccactggttcacggtccaaccg |
259 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||| ||| |||||| || | |||||||||||||| ||||||| |||||| |||||||| | |
|
|
| T |
31892549 |
ccggtttttaccgagccataccggttttaaccggttcaattacacgaccgatccaataatcagttcgaaccggttataccaccggttcatggtccaactg |
31892450 |
T |
 |
| Q |
260 |
gtc |
262 |
Q |
| |
|
||| |
|
|
| T |
31892449 |
gtc |
31892447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 158 - 253
Target Start/End: Original strand, 39375844 - 39375939
Alignment:
| Q |
158 |
caccggttttttccgagccacgccggttttaaccggttcaattgcacagccgatctgattaacagttcgaaccggtcataccactggttcacggtc |
253 |
Q |
| |
|
||||| ||||| |||| ||| || |||||||||||||||||||||| |||||||||| || || ||||||||| | ||||| ||||||||||| |
|
|
| T |
39375844 |
caccgatttttaccgaaccaagctggttttaaccggttcaattgcatgaccgatctgataaatagctcgaaccgggtacaccaccggttcacggtc |
39375939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 159 - 259
Target Start/End: Complemental strand, 27845094 - 27844994
Alignment:
| Q |
159 |
accggttttttccgagccacgccggttttaaccggttcaattgcacagccgatctgattaacagttcgaaccggtcataccactggttcacggtccaacc |
258 |
Q |
| |
|
|||||||||| |||| || ||||||||| ||||||||||||||| |||||| || ||||| | ||||||||||| ||| |||| ||||| ||||| |
|
|
| T |
27845094 |
accggtttttaacgagtcatgccggttttgaccggttcaattgcatgtccgatccaataaacagaccaaaccggtcatatcaccggtttacggttcaacc |
27844995 |
T |
 |
| Q |
259 |
g |
259 |
Q |
| |
|
| |
|
|
| T |
27844994 |
g |
27844994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 45; Significance: 1e-16; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 233
Target Start/End: Complemental strand, 18175525 - 18175453
Alignment:
| Q |
161 |
cggttttttccgagccacgccggttttaaccggttcaattgcacagccgatctgattaacagttcgaaccggt |
233 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||||||| ||||||||||| | ||| || ||||||| |
|
|
| T |
18175525 |
cggtttttttcgagccacgtcggttttaaccggttcaattgcacggccgatctgataaccagctcaaaccggt |
18175453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 233
Target Start/End: Original strand, 18224276 - 18224348
Alignment:
| Q |
161 |
cggttttttccgagccacgccggttttaaccggttcaattgcacagccgatctgattaacagttcgaaccggt |
233 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||||||| ||||||||||| | ||| || ||||||| |
|
|
| T |
18224276 |
cggtttttttcgagccacgtcggttttaaccggttcaattgcacggccgatctgataaccagctcaaaccggt |
18224348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 143 - 259
Target Start/End: Complemental strand, 4463657 - 4463542
Alignment:
| Q |
143 |
cgagtcaccggtttccaccggttttttccgagccacgccggttttaaccggttcaattgcacagccgatctgattaacagttcgaaccggtcataccact |
242 |
Q |
| |
|
|||||||||| |||||| || ||||| |||||||||||||||| ||||||||||||||||| | ||||| || | ||| || ||||| | ||| ||| |
|
|
| T |
4463657 |
cgagtcaccg-tttccatcgatttttatcgagccacgccggtttcaaccggttcaattgcacgactgatctaataaccagctcaaaccgattatatcacc |
4463559 |
T |
 |
| Q |
243 |
ggttcacggtccaaccg |
259 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
4463558 |
ggttcacggtccaaccg |
4463542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University