View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14368_low_19 (Length: 262)

Name: NF14368_low_19
Description: NF14368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14368_low_19
NF14368_low_19
[»] chr7 (5 HSPs)
chr7 (15-262)||(44605076-44605322)
chr7 (164-262)||(16216306-16216404)
chr7 (158-232)||(10198996-10199070)
chr7 (147-261)||(35332592-35332705)
chr7 (143-260)||(49033136-49033253)
[»] chr5 (2 HSPs)
chr5 (15-262)||(27193915-27194163)
chr5 (158-262)||(388980-389084)
[»] chr4 (5 HSPs)
chr4 (143-260)||(1935808-1935925)
chr4 (158-262)||(25231917-25232021)
chr4 (158-262)||(55676105-55676209)
chr4 (134-228)||(12703945-12704039)
chr4 (126-260)||(13427457-13427591)
[»] chr1 (3 HSPs)
chr1 (134-262)||(5384046-5384174)
chr1 (158-262)||(37034182-37034286)
chr1 (159-212)||(50324224-50324277)
[»] chr3 (2 HSPs)
chr3 (143-262)||(52403676-52403795)
chr3 (134-232)||(45159222-45159320)
[»] chr8 (4 HSPs)
chr8 (126-253)||(39025244-39025371)
chr8 (160-262)||(31892447-31892549)
chr8 (158-253)||(39375844-39375939)
chr8 (159-259)||(27844994-27845094)
[»] chr6 (3 HSPs)
chr6 (161-233)||(18175453-18175525)
chr6 (161-233)||(18224276-18224348)
chr6 (143-259)||(4463542-4463657)


Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 5)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 15 - 262
Target Start/End: Complemental strand, 44605322 - 44605076
Alignment:
15 catagggatcattgcattaattgtattaaatcaaccattaattaatattaatttgcgcataatggcactaattaatgacagaaaacagaaagnnnnnnnt 114  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||        |    
44605322 catagggatcattgcattaattgtattaaaccaaccattaattaatattaatttgcacataatggcactaattaatgacagaaaacagaaa-aaaaatat 44605224  T
115 attaaaccgggtgactctaaaaatcggtcgagtcaccggtttccaccggttttttccgagccacgccggttttaaccggttcaattgcacagccgatctg 214  Q
    ||||||||||||||||||||||| |||  |||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44605223 attaaaccgggtgactctaaaaaccggcagagttatcggtttccaccggttttttccgagccacgccggttttaaccggttcaattgcacagccgatctg 44605124  T
215 attaacagttcgaaccggtcataccactggttcacggtccaaccggtc 262  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||    
44605123 attaacagttcgaaccggtcataccactggttcactgtccaaccggtc 44605076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 164 - 262
Target Start/End: Complemental strand, 16216404 - 16216306
Alignment:
164 ttttttccgagccacgccggttttaaccggttcaattgcacagccgatctgattaacagttcgaaccggtcataccactggttcacggtccaaccggtc 262  Q
    ||||| |||||||| |||||||||||||||||||||||||   |||||||||| ||||| |||||||||  | ||||| |||||||||| ||| |||||    
16216404 tttttaccgagccaagccggttttaaccggttcaattgcatgaccgatctgataaacagctcgaaccgggtacaccaccggttcacggttcaatcggtc 16216306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 158 - 232
Target Start/End: Original strand, 10198996 - 10199070
Alignment:
158 caccggttttttccgagccacgccggttttaaccggttcaattgcacagccgatctgattaacagttcgaaccgg 232  Q
    ||||||||||| |||||||| ||| |||||||||||||||||||||   |||||||||| || || |||||||||    
10198996 caccggtttttaccgagccaagccagttttaaccggttcaattgcatgaccgatctgataaatagctcgaaccgg 10199070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 147 - 261
Target Start/End: Original strand, 35332592 - 35332705
Alignment:
147 tcaccggtttccaccggttttttccgagccacgccggttttaaccggttcaattgcacagccgatctgattaacagttcgaaccggtcataccactggtt 246  Q
    ||||||||||||| || |||| || ||||||||||| |||||||||||||||||||||   |||| |||| ||||  |||||||| | ||| ||| ||||    
35332592 tcaccggtttccatcgattttatc-gagccacgccgattttaaccggttcaattgcacgaacgatttgataaacaactcgaaccgattatatcaccggtt 35332690  T
247 cacggtccaaccggt 261  Q
    |||  ||||||||||    
35332691 cacaatccaaccggt 35332705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 143 - 260
Target Start/End: Original strand, 49033136 - 49033253
Alignment:
143 cgagtcaccggtttccaccggttttttccgagccacgccggttttaaccggttcaattgcacagccgatctgattaacagttcgaaccggtcataccact 242  Q
    ||||||||||||||||| |  ||||| |||||  ||||||||| | || ||||||| |||||| ||||||| ||   |||  |||||||||||| || |     
49033136 cgagtcaccggtttccagcaatttttaccgagttacgccggttctgactggttcaactgcacaaccgatctaataggcagaccgaaccggtcatccctcc 49033235  T
243 ggttcacggtccaaccgg 260  Q
    ||||| |||||| |||||    
49033236 ggttcgcggtccgaccgg 49033253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 15 - 262
Target Start/End: Complemental strand, 27194163 - 27193915
Alignment:
15 catagggatcattgcattaattgtattaaatcaaccattaattaatattaatttgcgcataatggcactaattaatgacagaaaacagaa-agnnnnnnn 113  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||| |            
27194163 catagggatcattgcattaattgtattaaaccaaccattaattaatattaatttgcacataatggcactaactaatgacagaaaacagaagaaaaaaaat 27194064  T
114 tattaaaccgggtgactctaaaaatcggtcgagtcaccggtttccaccggttttttccgagccacgccggttttaaccggttcaattgcacagccgatct 213  Q
    |||||||||||||||||||||||| ||| |||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||    
27194063 tattaaaccgggtgactctaaaaaccggccgagtcaccggtttccaccgattttttccgagccacgtcggttttaaccggttcaattgcacagccgatct 27193964  T
214 gattaacagttcgaaccggtcataccactggttcacggtccaaccggtc 262  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||    
27193963 gattaacagttcgaaccggtcataccactggttcgcggtccaaccggtc 27193915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 158 - 262
Target Start/End: Complemental strand, 389084 - 388980
Alignment:
158 caccggttttttccgagccacgccggttttaaccggttcaattgcacagccgatctgattaacagttcgaaccggtcataccactggttcacggtccaac 257  Q
    ||||||||||| |||||||| ||||||||||||||||||||||| |    ||||||||| ||||| |||||||||  ||||||| |||||||||||||||    
389084 caccggtttttaccgagccaagccggttttaaccggttcaattgtatgaacgatctgataaacagctcgaaccgggtataccaccggttcacggtccaac 388985  T
258 cggtc 262  Q
    |||||    
388984 cggtc 388980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 70; Significance: 1e-31; HSPs: 5)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 143 - 260
Target Start/End: Complemental strand, 1935925 - 1935808
Alignment:
143 cgagtcaccggtttccaccggttttttccgagccacgccggttttaaccggttcaattgcacagccgatctgattaacagttcgaaccggtcataccact 242  Q
    |||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||   |||||||||| ||||| |||||| ||  | |||||     
1935925 cgagtcaccggtttccaccggtttttaccgagccaagccggttttaaccggttcaattgcatgaccgatctgataaacagctcgaactgggtacaccacc 1935826  T
243 ggttcacggtccaaccgg 260  Q
    ||||||||||||||||||    
1935825 ggttcacggtccaaccgg 1935808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 158 - 262
Target Start/End: Complemental strand, 25232021 - 25231917
Alignment:
158 caccggttttttccgagccacgccggttttaaccggttcaattgcacagccgatctgattaacagttcgaaccggtcataccactggttcacggtccaac 257  Q
    ||||||||||| |||||||| |||||||||||||||||||||||||   ||| |||||| ||||| |||||||||  | ||||| |||||||||||||||    
25232021 caccggtttttaccgagccaagccggttttaaccggttcaattgcatgaccgttctgataaacagctcgaaccggatacaccaccggttcacggtccaac 25231922  T
258 cggtc 262  Q
    |||||    
25231921 cggtc 25231917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 158 - 262
Target Start/End: Original strand, 55676105 - 55676209
Alignment:
158 caccggttttttccgagccacgccggttttaaccggttcaattgcacagccgatctgattaacagttcgaaccggtcataccactggttcacggtccaac 257  Q
    ||||||||||| |||||||| |||||||||||||||||||||||||   | |||||||| ||||| | |||||||  | ||||| |||| ||||||||||    
55676105 caccggtttttaccgagccaagccggttttaaccggttcaattgcatgactgatctgataaacagcttgaaccggatacaccaccggtttacggtccaac 55676204  T
258 cggtc 262  Q
    |||||    
55676205 cggtc 55676209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 134 - 228
Target Start/End: Complemental strand, 12704039 - 12703945
Alignment:
134 aaaatcggtcgagtcaccggtttccaccggttttttccgagccacgccggttttaaccggttcaattgcacagccgatctgattaacagttcgaa 228  Q
    |||||||| ||||||| |||||||||||||||||| || |||||   || |||||||||||||||||||| | |||||||||| ||||| |||||    
12704039 aaaatcggccgagtcatcggtttccaccggtttttaccaagccaaatcgattttaaccggttcaattgcataaccgatctgataaacagctcgaa 12703945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 126 - 260
Target Start/End: Complemental strand, 13427591 - 13427457
Alignment:
126 tgactctaaaaatcggtcgagtcaccggtttccaccggttttttccgagccacgccggttttaaccggttcaattgcacagccgatctgattaacagttc 225  Q
    ||||||| |||| ||| | |||||||  |||||| || ||||| ||||||||| | | ||||||| || |||||||||| ||||||||| | | ||| ||    
13427591 tgactctgaaaaccggccaagtcaccaatttccaacgatttttaccgagccacacagattttaactggatcaattgcactgccgatctggtaatcagctc 13427492  T
226 gaaccggtcataccactggttcacggtccaaccgg 260  Q
     ||||||| ||||||| ||||||||||| ||||||    
13427491 aaaccggttataccaccggttcacggtcaaaccgg 13427457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 61; Significance: 3e-26; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 134 - 262
Target Start/End: Complemental strand, 5384174 - 5384046
Alignment:
134 aaaatcggtcgagtcaccggtttccaccggttttttccgagccacgccggttttaaccggttcaattgcacagccgatctgattaacagttcgaaccggt 233  Q
    |||| ||| ||||||||||||||||| |||||||| |||||||| |||||||||||||||||||||||||   || ||||||| ||||| ||||||||      
5384174 aaaaccggccgagtcaccggtttccatcggtttttaccgagccaagccggttttaaccggttcaattgcatgaccaatctgataaacagctcgaaccgag 5384075  T
234 cataccactggttcacggtccaaccggtc 262  Q
     | ||||  ||||||||||||||||||||    
5384074 tacaccaacggttcacggtccaaccggtc 5384046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 158 - 262
Target Start/End: Complemental strand, 37034286 - 37034182
Alignment:
158 caccggttttttccgagccacgccggttttaaccggttcaattgcacagccgatctgattaacagttcgaaccggtcataccactggttcacggtccaac 257  Q
    ||||||||||| |||||||| |||||||||||||||||||||||||   |||||||||| ||||  || ||||||  | ||||| |||| ||||||||||    
37034286 caccggtttttaccgagccaagccggttttaaccggttcaattgcatgaccgatctgataaacaactcaaaccggatacaccaccggtttacggtccaac 37034187  T
258 cggtc 262  Q
    |||||    
37034186 cggtc 37034182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 159 - 212
Target Start/End: Original strand, 50324224 - 50324277
Alignment:
159 accggttttttccgagccacgccggttttaaccggttcaattgcacagccgatc 212  Q
    ||||||||| |||||||||| |||||||| |||||||||| |||||||||||||    
50324224 accggttttatccgagccacaccggttttcaccggttcaagtgcacagccgatc 50324277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 56; Significance: 3e-23; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 143 - 262
Target Start/End: Complemental strand, 52403795 - 52403676
Alignment:
143 cgagtcaccggtttccaccggttttttccgagccacgccggttttaaccggttcaattgcacagccgatctgattaacagttcgaaccggtcataccact 242  Q
    ||||||| |||||||||||||||||  |||||||| |||| ||||||||||||||||||||   |||||||||| ||||| | |||||||  | |||||     
52403795 cgagtcatcggtttccaccggttttaaccgagccaagccgattttaaccggttcaattgcatgaccgatctgataaacagcttgaaccggatacaccacc 52403696  T
243 ggttcacggtccaaccggtc 262  Q
    |||||||||| |||||||||    
52403695 ggttcacggttcaaccggtc 52403676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 134 - 232
Target Start/End: Original strand, 45159222 - 45159320
Alignment:
134 aaaatcggtcgagtcaccggtttccaccggttttttccgagccacgccggttttaaccggttcaattgcacagccgatctgattaacagttcgaaccgg 232  Q
    |||| ||| |||||||||| ||||||||||||||| || ||||| |||||||||||||||||||||||||   ||||| |||| ||||| |||||||||    
45159222 aaaaccggccgagtcaccgatttccaccggtttttaccaagccaagccggttttaaccggttcaattgcatgaccgatatgataaacagctcgaaccgg 45159320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 52; Significance: 7e-21; HSPs: 4)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 126 - 253
Target Start/End: Original strand, 39025244 - 39025371
Alignment:
126 tgactctaaaaatcggtcgagtcaccggtttccaccggttttttccgagccacgccggttttaaccggttcaattgcacagccgatctgattaacagttc 225  Q
    |||||| ||||| ||| |||||||||||||||||||| ||||| |||||||| |||||| |||||| ||||||||| |    ||||||||||||||| ||    
39025244 tgactcaaaaaaccggccgagtcaccggtttccaccgatttttaccgagccaagccggtgttaaccagttcaattgtatgatcgatctgattaacagctc 39025343  T
226 gaaccggtcataccactggttcacggtc 253  Q
    |||||||  | ||||| | |||||||||    
39025344 gaaccggatacaccaccgattcacggtc 39025371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 160 - 262
Target Start/End: Complemental strand, 31892549 - 31892447
Alignment:
160 ccggttttttccgagccacgccggttttaaccggttcaattgcacagccgatctgattaacagttcgaaccggtcataccactggttcacggtccaaccg 259  Q
    ||||||||| ||||||||  ||||||||||||||||||||| |||  ||||||  || | |||||||||||||| ||||||| |||||| |||||||| |    
31892549 ccggtttttaccgagccataccggttttaaccggttcaattacacgaccgatccaataatcagttcgaaccggttataccaccggttcatggtccaactg 31892450  T
260 gtc 262  Q
    |||    
31892449 gtc 31892447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 158 - 253
Target Start/End: Original strand, 39375844 - 39375939
Alignment:
158 caccggttttttccgagccacgccggttttaaccggttcaattgcacagccgatctgattaacagttcgaaccggtcataccactggttcacggtc 253  Q
    ||||| ||||| |||| ||| || ||||||||||||||||||||||   |||||||||| || || |||||||||  | ||||| |||||||||||    
39375844 caccgatttttaccgaaccaagctggttttaaccggttcaattgcatgaccgatctgataaatagctcgaaccgggtacaccaccggttcacggtc 39375939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 159 - 259
Target Start/End: Complemental strand, 27845094 - 27844994
Alignment:
159 accggttttttccgagccacgccggttttaaccggttcaattgcacagccgatctgattaacagttcgaaccggtcataccactggttcacggtccaacc 258  Q
    ||||||||||  |||| || ||||||||| |||||||||||||||   ||||||  || |||||  | ||||||||||| ||| |||| ||||| |||||    
27845094 accggtttttaacgagtcatgccggttttgaccggttcaattgcatgtccgatccaataaacagaccaaaccggtcatatcaccggtttacggttcaacc 27844995  T
259 g 259  Q
    |    
27844994 g 27844994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 45; Significance: 1e-16; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 233
Target Start/End: Complemental strand, 18175525 - 18175453
Alignment:
161 cggttttttccgagccacgccggttttaaccggttcaattgcacagccgatctgattaacagttcgaaccggt 233  Q
    ||||||||| ||||||||| |||||||||||||||||||||||| ||||||||||| | ||| || |||||||    
18175525 cggtttttttcgagccacgtcggttttaaccggttcaattgcacggccgatctgataaccagctcaaaccggt 18175453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 233
Target Start/End: Original strand, 18224276 - 18224348
Alignment:
161 cggttttttccgagccacgccggttttaaccggttcaattgcacagccgatctgattaacagttcgaaccggt 233  Q
    ||||||||| ||||||||| |||||||||||||||||||||||| ||||||||||| | ||| || |||||||    
18224276 cggtttttttcgagccacgtcggttttaaccggttcaattgcacggccgatctgataaccagctcaaaccggt 18224348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 143 - 259
Target Start/End: Complemental strand, 4463657 - 4463542
Alignment:
143 cgagtcaccggtttccaccggttttttccgagccacgccggttttaaccggttcaattgcacagccgatctgattaacagttcgaaccggtcataccact 242  Q
    |||||||||| |||||| || |||||  |||||||||||||||| |||||||||||||||||  | ||||| || | ||| || ||||| | ||| |||     
4463657 cgagtcaccg-tttccatcgatttttatcgagccacgccggtttcaaccggttcaattgcacgactgatctaataaccagctcaaaccgattatatcacc 4463559  T
243 ggttcacggtccaaccg 259  Q
    |||||||||||||||||    
4463558 ggttcacggtccaaccg 4463542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University