View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14368_low_26 (Length: 216)
Name: NF14368_low_26
Description: NF14368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14368_low_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 20 - 202
Target Start/End: Complemental strand, 52762175 - 52761994
Alignment:
| Q |
20 |
ttgcgatcagaacctatgcaacttgttcaattgatcattccaattgaatcagctcagcgatccatctcttaccttggcgatctcggcctttttcaattca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52762175 |
ttgcgatcagaacctatgcaacttgttcaattgatcattccaattgaatcagctcagcgatccatctcttaccttggcgatctcggcctttttcaattca |
52762076 |
T |
 |
| Q |
120 |
aagatgtatgaatcctttaattaccaatctttgtcctttctcactttgcattcttgatgacgcttcggactacattttccata |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
52762075 |
aagatgtatgaatcctttaattaccaatctttgtcc-ttctcactttgtattctttatgacgcttcggactacattttccata |
52761994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University