View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14369_high_4 (Length: 374)
Name: NF14369_high_4
Description: NF14369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14369_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 336; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 336; E-Value: 0
Query Start/End: Original strand, 21 - 364
Target Start/End: Complemental strand, 5954999 - 5954656
Alignment:
| Q |
21 |
tttatccgaccaaggaggtcttcactgtctcgatgtatttagacgaagcttattgcgctcaggacctcaaccagcacctagaatatggatcagacgcagg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5954999 |
tttatccgaccaaggaggtcttcactgtctcgatgtatttagacgaagcttattgcgctcaggacctcaaccagcacctagaatatggatcaaacgcagg |
5954900 |
T |
 |
| Q |
121 |
tcgaacgctaatagagttgcagacaaacggcgccagcaactgatacattgtgtaactgagctaaaagaggctggaatcaagttcaagaaaaggaagaccg |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5954899 |
tcgaacgctaatagagttgcagacaaacggcgccagcaactgatacattgtgtaactgagctaaaagaggctggaatcaagttcaagaaaaggaagaccg |
5954800 |
T |
 |
| Q |
221 |
atcgcttctgggatattaaatttaaggacggtattctgcgtattccgagactcttgatccatgatggaacaaaatctctgtttctaaacctcattgcatt |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5954799 |
atcgcttctgggatattaaatttaaggacggtattctgcgtattccgagactcttgatccatgatggaacaaaatctctgtttctaaacctcattgcatt |
5954700 |
T |
 |
| Q |
321 |
tgagcagtgtcatcttgattgcagtaatgacattacatcctatg |
364 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5954699 |
tgagcagtgtcatcttgattgcagcaatgacattacatcctatg |
5954656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University