View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14369_low_4 (Length: 409)
Name: NF14369_low_4
Description: NF14369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14369_low_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 158; Significance: 6e-84; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 158; E-Value: 6e-84
Query Start/End: Original strand, 230 - 399
Target Start/End: Original strand, 50409976 - 50410145
Alignment:
| Q |
230 |
agaatcttatgaagatgaatttgagacattgtcaacgacgaggaatgagtcagctaagggttcgagtagcgtcccacgagttcccaaacaggagcttgtg |
329 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50409976 |
agaatcttatgaagatgaatttgagacgttgtcaacgacgaggaacgagtcagctaagggttcgagtagcgtcccacgagttcccaaacaggagcttgtg |
50410075 |
T |
|
| Q |
330 |
gatgaagaagaatttgatagattgatggaagaacgtgttaattctaggtttttccgttttgctgatgatg |
399 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
50410076 |
gatgaagaagaatttgatagattgatggaagaacgtgttaattctaggtttttccgttttgctgaagatg |
50410145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 20 - 120
Target Start/End: Original strand, 50409766 - 50409866
Alignment:
| Q |
20 |
gaagccgctgacgtcgatagcgatgacagcgagttcagcgatttcagcgacggtacattctctctattccttcatttgttgatctcgctagaaatgttag |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50409766 |
gaagccgctgacgtcgatagcgatgacagcgagttcagcgatttcagcgacggtacattctctctattccttcatttgttgatctcgctagaaatgttag |
50409865 |
T |
|
| Q |
120 |
g |
120 |
Q |
| |
|
| |
|
|
| T |
50409866 |
g |
50409866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University