View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1436_high_14 (Length: 250)
Name: NF1436_high_14
Description: NF1436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1436_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 13 - 248
Target Start/End: Original strand, 45191784 - 45192019
Alignment:
| Q |
13 |
aatatagcagagataagcttcataagttgattgatcaaaatattgcagatactataagtcctgaatcatacaagatttttgtacaaattggtgtgaaatg |
112 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45191784 |
aatatagcagagataagcttcataagctgattgatcaaaatattgcagatactataagtcctgaatcatacaagatttttgtacaaattggtgtgaaatg |
45191883 |
T |
 |
| Q |
113 |
tttggctgatcatggagttgataggcctagtatgggtgatgtgttgtggcatttggaacatgctttacaacaacagttagcttcatcacatattgatact |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45191884 |
tttggctgatcatggagttgataggcctagtatgggtgatgtgttgtggcatttggaacatgctttacaacaacagttagcttcatcacatattgatact |
45191983 |
T |
 |
| Q |
213 |
atacctatagataacaacacaaattcacatattcat |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
45191984 |
atacctatagataacaacacaaattcacatattcat |
45192019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 107 - 175
Target Start/End: Complemental strand, 45097783 - 45097715
Alignment:
| Q |
107 |
gaaatgtttggctgatcatggagttgataggcctagtatgggtgatgtgttgtggcatttggaacatgc |
175 |
Q |
| |
|
||||||||||||||| |||| |||||||| || | |||||||||||| |||||| |||||||| |||| |
|
|
| T |
45097783 |
gaaatgtttggctgaatatggtgttgatagaccaactatgggtgatgtcttgtggaatttggaatatgc |
45097715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 107 - 140
Target Start/End: Complemental strand, 13973408 - 13973375
Alignment:
| Q |
107 |
gaaatgtttggctgatcatggagttgataggcct |
140 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
13973408 |
gaaatgtttggctgatcatggtgttgataggcct |
13973375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 107 - 176
Target Start/End: Complemental strand, 41048364 - 41048295
Alignment:
| Q |
107 |
gaaatgtttggctgatcatggagttgataggcctagtatgggtgatgtgttgtggcatttggaacatgct |
176 |
Q |
| |
|
|||||||||||||||| |||| ||||| |||||| ||||| ||||| |||||| |||||||| ||||| |
|
|
| T |
41048364 |
gaaatgtttggctgattatggtgttgacaggccttccatgggagatgtcttgtggaatttggaatatgct |
41048295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University