View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1436_high_21 (Length: 236)
Name: NF1436_high_21
Description: NF1436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1436_high_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 43091686 - 43091462
Alignment:
| Q |
1 |
actcaacttctatatcaatcatgtccatatcaggcagcaaccttgttgataatcggaccatatttggataaaattctcactgatctaaatgtttttgctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43091686 |
actcaacttctatatcaatcatgtccatatcaggcagcaaccttgttgataatcggaccatatttggataaaattctcactgatctaaatgtttttgctt |
43091587 |
T |
|
| Q |
101 |
tcaagtacacaacacaagtgacggtgagatttaaaaaagacatttgtgcttattgttgaacttaaactctttctgtctactaatatattaattctatgca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43091586 |
tcaagtacacaacacaagtgacggtgagatttaaaaaagacatttgtgcttattgttgaacttaaactctttctgtctactaatatattaattttatgca |
43091487 |
T |
|
| Q |
201 |
ttgtagtttgccatcgttctttcat |
225 |
Q |
| |
|
| ||||||||||||||||||||||| |
|
|
| T |
43091486 |
tcgtagtttgccatcgttctttcat |
43091462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 7 - 137
Target Start/End: Complemental strand, 43084167 - 43084037
Alignment:
| Q |
7 |
cttctatatcaatcatgtccatatcaggcagcaaccttgttgataatcggaccatatttggataaaattctcactgatctaaatgtttttgctttcaagt |
106 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||||| |||| || || |||||| |||||||| || | || || | |||||| |||| |||||||| |
|
|
| T |
43084167 |
cttctataccaatcatgtccatatcaagcagcaaccctgttaatctctggtccatatctggataaacttttaaccgaccaaaatgtatttggtttcaagt |
43084068 |
T |
|
| Q |
107 |
acacaacacaagtgacggtgagatttaaaaa |
137 |
Q |
| |
|
||||||| ||||||||||| ||| ||||||| |
|
|
| T |
43084067 |
acacaacgcaagtgacggtaagagttaaaaa |
43084037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University