View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1436_low_14 (Length: 261)
Name: NF1436_low_14
Description: NF1436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1436_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 14 - 245
Target Start/End: Complemental strand, 36875217 - 36874969
Alignment:
| Q |
14 |
atattgccttgtttggttaaaatcagacaacagagtcaaccaactacaatgtactgtatctccagatgt-----------------gcgctctagtatgt |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
36875217 |
atattgccttgtttggttaaaatcagacaacagagtcaaccaactacaatgtactgtatctccagatgtatttggaaataggatgtgcgctctagtatgt |
36875118 |
T |
 |
| Q |
97 |
tgtannnnnnngtcgcatcttcagtgagacctataaaggnnnnnnnnagccacggtattttcaataaattaccatctttcgcctccgttggaatttcaac |
196 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
36875117 |
tgtatttttttgtcccatcttcagtgagacctataaagattttttttagccacggtattttcaaaaaattaccatctttcgcctccgttggaatttcaac |
36875018 |
T |
 |
| Q |
197 |
tcccaacgattaattctttacaccatgatcagccaatgcttgccatacc |
245 |
Q |
| |
|
||||||| |||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
36875017 |
tcccaacaattaattctttacaccatgaccagccaatgcttgccatacc |
36874969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University