View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1436_low_25 (Length: 234)
Name: NF1436_low_25
Description: NF1436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1436_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 142
Target Start/End: Complemental strand, 1251972 - 1251826
Alignment:
| Q |
1 |
tatacaaaaatgacaatttagtaaaagtaacatat--ttttagataaatttgtgatttcaacaattttttat--caatactcatgatttttattgtaaag |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
1251972 |
tatacaaaaatgacaatttagtaaaagtaacatatatttttagataaatttgtgatttcaacaattttttttaacaatactcatgatttttattgtaaag |
1251873 |
T |
 |
| Q |
97 |
tagttttataa-aaaagatggtcagataagtagagtaattagtaata |
142 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
1251872 |
tagttttataaaaaaagatggtcagataagtagagtaattagtaata |
1251826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 153 - 229
Target Start/End: Complemental strand, 1250198 - 1250122
Alignment:
| Q |
153 |
ccattgtaaccacatgtgactataaatttaaaacgtcacatgccgaattttaatcaggacatgaatcatgatgatgt |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1250198 |
ccattgtaaccacatgtgactataaatttaaaacgtcacatgccgaattttaatcaggacatgaatcatgatgatgt |
1250122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University