View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1436_low_28 (Length: 206)
Name: NF1436_low_28
Description: NF1436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1436_low_28 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 172; Significance: 1e-92; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 17 - 188
Target Start/End: Original strand, 26421369 - 26421540
Alignment:
| Q |
17 |
aaaataatcagaaaaataagtggacttaaaatctagcaggagaacgagaggagggatgaaaattaagaggtttggactagatggagtaaaatcaccatac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26421369 |
aaaataatcagaaaaataagtggacttaaaatctagcaggagaacgagaggagggatgaaaattaagaggtttggactagatggagtaaaatcaccatac |
26421468 |
T |
|
| Q |
117 |
agtcactactttcagaagcataacgagggtagggatgagaaataagaggtttggattagatggagtataaac |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26421469 |
agtcactactttcagaagcataacgagggtagggatgagaaataagaggtttggattagatggagtataaac |
26421540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 59 - 138
Target Start/End: Original strand, 26421490 - 26421569
Alignment:
| Q |
59 |
aacgagaggagggatgaaaattaagaggtttggactagatggagtaaaatcaccatacagtcactactttcagaagcata |
138 |
Q |
| |
|
|||||| | |||||||| || ||||||||||||| ||||||||||| || |||||| ||||||||||||||||||||||| |
|
|
| T |
26421490 |
aacgagggtagggatgagaaataagaggtttggattagatggagtataaacaccatgcagtcactactttcagaagcata |
26421569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University