View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14371_low_12 (Length: 278)
Name: NF14371_low_12
Description: NF14371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14371_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 7 - 270
Target Start/End: Original strand, 4554289 - 4554552
Alignment:
| Q |
7 |
cttggtgctttgcattacagtttatggtactaacaatgatgactcgttctcaagacagaaggttttggaagttgagaaaaaattacaccatcttagaaaa |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
4554289 |
cttggtgctttgcattacagtttatggtactaacaatgatgactcgttctcaagacagaaggttttggaagttgagaaaaaattacagcatcttagaaaa |
4554388 |
T |
|
| Q |
107 |
cactcgttaaaaaccattaaggtaaaaagttttctttggtatactagacaatatcttacactgttgaatgttgtgtgagatttgatattgtttacatttt |
206 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
4554389 |
cactcattaaaaaccattaaggtaaaaagttttctttggtatactagacaatatcttacactgttgaatgttgtgttagatttgatattgtttagatttt |
4554488 |
T |
|
| Q |
207 |
ctaaattgtcacacaaggtgctaagcttaattataannnnnnncatgcttgtagagtgatgatg |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
4554489 |
ctaaattgtcacacaaggtgctaagcttaattataatttttttcatgcttgtagagtgaagatg |
4554552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University