View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14372_high_10 (Length: 247)
Name: NF14372_high_10
Description: NF14372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14372_high_10 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 231; Significance: 1e-128; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 231; E-Value: 1e-128
Query Start/End: Original strand, 1 - 247
Target Start/End: Complemental strand, 7451527 - 7451281
Alignment:
| Q |
1 |
caattttgttgtgttgtatatgtcacacacaaacaatacacttccatgtttccctccttccatactaatacctttcacgctagccattgaataaaatatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
7451527 |
caattttgttgtgttgtatatgtcacacacaaacaatacacttccatgtttccctccttccatactaatccctttcacgctagccattgaataaaatatt |
7451428 |
T |
 |
| Q |
101 |
actcccattactacgtgcttagtttaatatcagtggctatatcaattttttaagtaagtgtatatgcatggctgtgaactgaacgggtaagcctccactg |
200 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7451427 |
actcccattaccacgtgcttaatttaatatcagtggctatatcaattttttaagtaagtgtatatgcatggttgtgaactgaacgggtaagcctccactg |
7451328 |
T |
 |
| Q |
201 |
ttcctttccttctttatgcttcacctatagctctagttttcaacaac |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7451327 |
ttcctttccttctttatgcttcacctatagctctagttttcaacaac |
7451281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University