View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14372_high_4 (Length: 458)
Name: NF14372_high_4
Description: NF14372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14372_high_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 115; Significance: 3e-58; HSPs: 5)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 115; E-Value: 3e-58
Query Start/End: Original strand, 139 - 290
Target Start/End: Complemental strand, 35986699 - 35986548
Alignment:
| Q |
139 |
gggtgtataaaatgagatgagttttattgtgagagggtgagagcaataaataacagccattggattaaaataaagggttcatannnnnnnacacttaaaa |
238 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
35986699 |
gggtgtatcaaatgagaggagttttattgtgagaggatgagagcaataaataacagccattggattaaaataaagggttcagatttttttacacttaaaa |
35986600 |
T |
 |
| Q |
239 |
ctgctagctcctacattatccatcgcccactctcggtctatctccatccccg |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35986599 |
ctgctagctcctacattatccatcgcccactctcggtctatctccatccccg |
35986548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 161 - 290
Target Start/End: Complemental strand, 11008758 - 11008629
Alignment:
| Q |
161 |
tttattgtgagagggtgagagcaataaataacagccattggattaaaataaagggttcatannnnnnnacacttaaaactgctagctcctacattatcca |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
11008758 |
tttattgtgagagggtgagagcaataaataacagtcattggattaaaataaagggttcatatttttttacacttaaaactgctagctcctacattatcca |
11008659 |
T |
 |
| Q |
261 |
tcgcccactctcggtctatctccatccccg |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
11008658 |
tcgcccactctcggtctatctccatccccg |
11008629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 356 - 405
Target Start/End: Complemental strand, 11008563 - 11008514
Alignment:
| Q |
356 |
acaagaacatgtttgttccatatcacaaaacaaaaaggcttcgttccata |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11008563 |
acaagaacatgtttgttccatatcacaaaacaaaaaggcttcgttccata |
11008514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 356 - 405
Target Start/End: Complemental strand, 35986482 - 35986433
Alignment:
| Q |
356 |
acaagaacatgtttgttccatatcacaaaacaaaaaggcttcgttccata |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35986482 |
acaagaacatgtttgttccatatcacaaaacaaaaaggcttcgttccata |
35986433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 358 - 403
Target Start/End: Original strand, 28749117 - 28749162
Alignment:
| Q |
358 |
aagaacatgtttgttccatatcacaaaacaaaaaggcttcgttcca |
403 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
28749117 |
aagaacatggttgttccatatcacaaaacaaaaaggcttcgttcca |
28749162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 23483107 - 23483168
Alignment:
| Q |
1 |
gagggtaatgtgaaccaaaaatcacgctgaaacattgcagacataaagcttcagaaacacac |
62 |
Q |
| |
|
|||| ||| |||||||||||| || |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
23483107 |
gaggttaacgtgaaccaaaaaccatgctgaaacattgcagacataaagcttcagaaaaacac |
23483168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 160 - 212
Target Start/End: Complemental strand, 1514492 - 1514440
Alignment:
| Q |
160 |
ttttattgtgagagggtgagagcaataaataacagccattggattaaaataaa |
212 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||||| || ||||||||| |
|
|
| T |
1514492 |
ttttattgtgagagggtgagagcattaaatatcagccataagaataaaataaa |
1514440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University