View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14372_high_9 (Length: 284)
Name: NF14372_high_9
Description: NF14372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14372_high_9 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 19 - 284
Target Start/End: Original strand, 38118628 - 38118893
Alignment:
| Q |
19 |
tgctcaacacacaaaacactatagacaatgttcgtcattggtctgttaacaacgtatcatttttccttcctcacaccccttatcttgttgcacttaaaga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38118628 |
tgctcaacacacaaaacactatagacaatgttcgtcattggtctgttaacaacgtatcatttttccttcctcacaccccttatcttgttgcacttaaaga |
38118727 |
T |
|
| Q |
119 |
gaatataactggtgaattcaaccaaacacctccacctgatggctatgattttaataattatgatattttcagcgtggctaacaacacaaatgctacttct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
38118728 |
gaatataactggtgaattcaaccaaacacctccacctgatggctatgattttaataattatgatattttcagtgtggctaacaacacaaatgctacttct |
38118827 |
T |
|
| Q |
219 |
agcaatggaatttatagactgaagttcaatacaactgtggatattatacttcaaaatgcaaacact |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38118828 |
agcaatggaatttatagactgaagttcaatacaactgtggatattatacttcaaaatgcaaacact |
38118893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University