View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14372_low_9 (Length: 288)
Name: NF14372_low_9
Description: NF14372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14372_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 13 - 270
Target Start/End: Original strand, 43021316 - 43021573
Alignment:
| Q |
13 |
aatatcaacatttacatcaatacacacattggataaagcttgttcaattgcagctttacccttcagtttttgaagaaagataccgcgtagtttatcttca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43021316 |
aatatcaacatttacatcaatacacacattggataaagcttgttcaattgcagctttacccttcagtttttgaagaaagataccgcgtagtttatcttca |
43021415 |
T |
 |
| Q |
113 |
ggggacaaaaacccatcaatggatttagaatctgattgtgaatctggggttttggaagtgggtattggtaaaagttgggagatttgatggagaatgaggc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43021416 |
ggggacaaaaacccatcaatggatttagaatctgattgtgaatctggggttttggaagtgggtattggtaaaagttgggagatttgatggagaatgaggc |
43021515 |
T |
 |
| Q |
213 |
gttcatcaaggtttgatgaattttgtagcgatgagaaacgttgatgtaatttgggaag |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43021516 |
gttcatcaaggtttgatgaattttgtagcgatgagaaacgttgatgtaatttgggaag |
43021573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University