View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14374_high_19 (Length: 237)
Name: NF14374_high_19
Description: NF14374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14374_high_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 96 - 221
Target Start/End: Original strand, 41917178 - 41917303
Alignment:
| Q |
96 |
tatgaatattatatatgaaattggtaggattttactatatgtattaagattcatannnnnnnactatgaatacattggttaggtttggtatctagtcaat |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
41917178 |
tatgaatattatatatgaaattggtaggattttactatatgtattaagattcatatttttttactatgactacattggttaggtttggtatctagtcaat |
41917277 |
T |
|
| Q |
196 |
gtgtatggaaaaatatatgatggaat |
221 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
41917278 |
gtgtatggaaaaatatatgatggaat |
41917303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University