View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14374_high_23 (Length: 223)
Name: NF14374_high_23
Description: NF14374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14374_high_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 13 - 206
Target Start/End: Original strand, 21625342 - 21625535
Alignment:
| Q |
13 |
agcataggtttgatggggttggtttctcaagctgtttctgatggaggtcgacatgtgattgggtgagaaatgagcatcttcttccttatgatcgatttgt |
112 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21625342 |
agcattggtttgatggggttggtttctcaagctgtttctgatggaggtcgacatgtgattgggtgagaaatgagcatcttcttccttatgatcgatttgt |
21625441 |
T |
 |
| Q |
113 |
cttggtgatgatgttgttaatttatgctatttttattgtcattgtattgttgcagggttattccaaggacattgatgccaagagaggtaatttt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21625442 |
cttggtgatgatgttgttaatttatgctatttttattgtcattgtattgttgcagggttattccaaggacattgatgccaagagaggtaatttt |
21625535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 13 - 76
Target Start/End: Complemental strand, 40465860 - 40465797
Alignment:
| Q |
13 |
agcataggtttgatggggttggtttctcaagctgtttctgatggaggtcgacatgtgattgggt |
76 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||| |||||| ||||||||||| ||||||| |
|
|
| T |
40465860 |
agcattggtttgatggggttgatttctcaagctgtttatgatggtggtcgacatgtaattgggt |
40465797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University