View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14374_high_9 (Length: 394)
Name: NF14374_high_9
Description: NF14374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14374_high_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 290; Significance: 1e-162; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 290; E-Value: 1e-162
Query Start/End: Original strand, 1 - 375
Target Start/End: Complemental strand, 24568382 - 24568010
Alignment:
| Q |
1 |
gcatattctaactttgaatatcgcaaacttttgcacaatttggaattataatataattgcagataccagatagaatatgtgaaggacggtttgcactcat |
100 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24568382 |
gcatattctacctttgaatattgcaaacttttgcacaatttggaattataatataattgcagataccagatagaatatgtgaaggacggtttgcactcat |
24568283 |
T |
|
| Q |
101 |
tagaaggccttaattgttcgatattggtgtcttccctttcacacggttgtggtcccttatttgttgggcatgatcatatattacatgttcattcatatgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24568282 |
tagaaggccttaattgttcgatattggtgtcttctctttcacacggttgtggtcccttatttgttgggcatgatcatatattacatgttcattcatatgt |
24568183 |
T |
|
| Q |
201 |
acatccccatgcacattatacattactgcaacacgtgnnnnnnnnntaaaacttgtgcagttattgtgcattcaattgccttaaatttatgnnnnnnnnn |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
24568182 |
acatccccatgcacattatacattactgcaacacgtgcaaaaaaaataaaacttgtgcagttattgtgcattcaattaccttaaatttatg--ttttttt |
24568085 |
T |
|
| Q |
301 |
nngtgtgaatttgttgtagaatattctgcaaaatggttcccttttgtgtaacatatttattatcctatactacta |
375 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24568084 |
ttgtgtgaatttgttgtagaatattctgcaaaatggttcccttttgtgcaacatatttattatcctatactacta |
24568010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University