View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14374_low_15 (Length: 310)
Name: NF14374_low_15
Description: NF14374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14374_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 7 - 306
Target Start/End: Original strand, 6988855 - 6989154
Alignment:
| Q |
7 |
gcagcttggatttctgcgagagtgaaatttttccatgaagatttgaagcacataaactcagaatcaaaagaagactgaagagctggagaattgagagatg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6988855 |
gcagcttggatttctgcgagagtgaaatttttccatgaagatttgaagcacataaactcagaatcaaaagaagactgaagagctggagaattgagagatg |
6988954 |
T |
 |
| Q |
107 |
gaatgaattcctccctaattcttttgctctttcgtctagtaagttttggaacatttttcagtggatgaaaggtatgaaatggcatttgtggtcccttttt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6988955 |
gaatgaattcctccctaattcttttgctctttcgtctagtaagttttggaacatttttcagtggatgaaaggtatgaaatggcatttgtggtcccttttt |
6989054 |
T |
 |
| Q |
207 |
gattaatttaaagaaacctcgccattgtcttgtacctccctcggaatcagaagtgcttgcccttgaacttggtgtatcagattcttgaattctaggtgaa |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
6989055 |
gattaatttaaagaaacctcgccattgtcttgtacctccctcggaatcagaagtgcttgcccttgaacttggtgtatcagattcttgacttctaggtgaa |
6989154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University