View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14374_low_16 (Length: 305)
Name: NF14374_low_16
Description: NF14374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14374_low_16 |
 |  |
|
| [»] scaffold0002 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0002 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 34 - 269
Target Start/End: Complemental strand, 480880 - 480645
Alignment:
| Q |
34 |
catctaacaaaacactccagcatattatagtgtccacaacaaaattattattaatcatcaatgcggtattcataatcatttcacaacttggaattaaatt |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
480880 |
catctaacaaaacactccagcatattatagtgtccacaacaaaattattattaatcatcaatgcggtagtcataatcatttcacatcttggaattaaatt |
480781 |
T |
 |
| Q |
134 |
acaatgcaacttcatcaatcttgtacatggaaatgaaataaattattgatcatcaaaaaccatgaaaaggatgaaagaaatcatcaccattaaactcatc |
233 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
480780 |
acaatgcaacttcatcgatcttgtacatggaaatgaaataaattatagatcatcaaaaaccatgaaaaggatgaaagaaatcatcaccattaaactcatc |
480681 |
T |
 |
| Q |
234 |
agaatcatacaagaacccatacatcaaatccgtgtg |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
480680 |
agaatcatacaagaacccatacatcaaatccgtgtg |
480645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 264 - 301
Target Start/End: Complemental strand, 479417 - 479380
Alignment:
| Q |
264 |
cgtgtgatcagattcaagcctagatatagaataatcta |
301 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
479417 |
cgtgtgatcagattcaagtctagatatagaattatcta |
479380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University