View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14374_low_17 (Length: 298)
Name: NF14374_low_17
Description: NF14374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14374_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 255; Significance: 1e-142; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 17 - 271
Target Start/End: Complemental strand, 49904360 - 49904106
Alignment:
| Q |
17 |
agggattatgttcttgtcaaggcttgaacaaaggaaattggggcttctggtaacggtggcaacaatgtctttgggagaagcacctttggaggctaaaaat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49904360 |
agggattatgttcttgtcaaggcttgaacaaaggaaattggggcttctggtaacggtggcaacaatgtctttgggagaagcacctttggaggctaaaaat |
49904261 |
T |
|
| Q |
117 |
tgaaactttggcaaaatggttttaatggggttgtaaacgatgagcaatggaatcttgcgaatgatggtttgtatctggtgatcggagaaaccgtgggttt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49904260 |
tgaaactttggcaaaatggttttaatggggttgtaaacgatgagcaatggaatcttgcgaatgatggtttgtatctggtgatcggagaaaccgtgggttt |
49904161 |
T |
|
| Q |
217 |
tgaaaaaggcgataacggaatcgggtttgtcgggagtgttgaaacgaagtcgttt |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49904160 |
tgaaaaaggcgataacggaatcgggtttgtcgggagtgttgaaacgaagtcgttt |
49904106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 90 - 271
Target Start/End: Original strand, 49563143 - 49563324
Alignment:
| Q |
90 |
ggagaagcacctttggaggctaaaaattgaaactttggcaaaatggttttaatggggttgtaaacgatgagcaatggaatcttgcgaatgatggtttgta |
189 |
Q |
| |
|
|||||| | |||||||| ||||||||||||| |||||||||||||| ||| |||||||| | |||| | || ||| | |||| ||||||| ||||| |
|
|
| T |
49563143 |
ggagaaacgcctttggaagctaaaaattgaagctttggcaaaatggatttgatggggtttgagacgaaaaccaggggatccctgcggatgatggattgta |
49563242 |
T |
|
| Q |
190 |
tctggtgatcggagaaaccgtgggttttgaaaaaggcgataacggaatcgggtttgtcgggagtgttgaaacgaagtcgttt |
271 |
Q |
| |
|
|||| | | ||||||||| ||||||||||||||||| ||||| | ||||||||| || || |||||||||||||||||||| |
|
|
| T |
49563243 |
tctgatcaatggagaaaccatgggttttgaaaaaggcaataacagtatcgggtttatccggggtgttgaaacgaagtcgttt |
49563324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 57 - 133
Target Start/End: Original strand, 49558947 - 49559023
Alignment:
| Q |
57 |
gggcttctggtaacggtggcaacaatgtctttgggagaagcacctttggaggctaaaaattgaaactttggcaaaat |
133 |
Q |
| |
|
||||||||||| | || |||||||||||||| ||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
49558947 |
gggcttctggtgatggcggcaacaatgtcttggggagaagcacctttggagtataaaaattgaatctttggcaaaat |
49559023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 179 - 271
Target Start/End: Original strand, 49559025 - 49559117
Alignment:
| Q |
179 |
gatggtttgtatctggtgatcggagaaaccgtgggttttgaaaaaggcgataacggaatcgggtttgtcgggagtgttgaaacgaagtcgttt |
271 |
Q |
| |
|
||||||||||||||| |||| ||||||| |||||||||||||||||| |||||| ||||||| ||||| || ||||| ||||||||| |||| |
|
|
| T |
49559025 |
gatggtttgtatctgatgattggagaaagcgtgggttttgaaaaaggagataaccgaatcggctttgtgaggggtgtttaaacgaagttgttt |
49559117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 92 - 132
Target Start/End: Complemental strand, 49553411 - 49553371
Alignment:
| Q |
92 |
agaagcacctttggaggctaaaaattgaaactttggcaaaa |
132 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
49553411 |
agaagcacctttggagagtaaaaattgaaactttggtaaaa |
49553371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 92 - 130
Target Start/End: Complemental strand, 14520157 - 14520119
Alignment:
| Q |
92 |
agaagcacctttggaggctaaaaattgaaactttggcaa |
130 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
14520157 |
agaagcacctttggagagtaaaaattgaaactttggcaa |
14520119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 92 - 132
Target Start/End: Original strand, 14476157 - 14476197
Alignment:
| Q |
92 |
agaagcacctttggaggctaaaaattgaaactttggcaaaa |
132 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
14476157 |
agaagcacctttggagagaaaaaattgaaactttggcaaaa |
14476197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University