View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14374_low_20 (Length: 254)
Name: NF14374_low_20
Description: NF14374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14374_low_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 207 - 245
Target Start/End: Original strand, 30168411 - 30168449
Alignment:
| Q |
207 |
cccaattttggaagtcctacgtgtctttttcttctctct |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30168411 |
cccaattttggaagtcctacgtgtctttttcttctctct |
30168449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 134 - 178
Target Start/End: Original strand, 43245384 - 43245428
Alignment:
| Q |
134 |
aaagggaaatgctgaaatttacaaatgaaacaagcaagaaatgca |
178 |
Q |
| |
|
||||| |||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
43245384 |
aaaggaaaatgctgaaatttacgaatgtaacaagcaagaaatgca |
43245428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University