View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14374_low_24 (Length: 235)
Name: NF14374_low_24
Description: NF14374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14374_low_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 37959867 - 37959657
Alignment:
| Q |
1 |
tgaaaaccctcggctcctttaatttgcagcagacactccaaccttaatcttatcttcttaaatgattggttgaaaattgaaatattggtgcaaaccagtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37959867 |
tgaaaaccctcggctcctttaatttgcagcagacactccaatcttaatcttatcttcttaaatgattggttgaaaattgaaatattggtgcaaaccagtt |
37959768 |
T |
 |
| Q |
101 |
gagtgggtctctaccttaatctgtc-nnnnnnngcatgacttactgtagctgattctaagtcaagcagagaacaagatactccgaaaatacatggaggtt |
199 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
37959767 |
-agtgggtctctaccttaatctgtcttttttttgcatgact---------tgattctaagtcaagcagagaacaagatacttcgaaaatacatggaggtt |
37959678 |
T |
 |
| Q |
200 |
taagctccaacaagtctttat |
220 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
37959677 |
taagctccaacaagtctttat |
37959657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University