View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14374_low_8 (Length: 432)
Name: NF14374_low_8
Description: NF14374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14374_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 282; Significance: 1e-158; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 11 - 315
Target Start/End: Original strand, 12218872 - 12219174
Alignment:
| Q |
11 |
attatacttgtaaaatatgaaatgaatttttagcaagataaccaaccttctttgcttattgcatagaaatgttggtgtaatatatatcatctgagaattg |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
12218872 |
attatacttgtaaaatatgaaatgaatttttagcaagataaccaaccttctttgcttattgcatagaaatgttggtgtagtatatatcatctgagaattg |
12218971 |
T |
|
| Q |
111 |
actttacaaaatgaatgagaatagatgagattcattcatgctactaatggtgaaaatgagacaactcaatagcatcgtcctttccctttagtttgtacat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12218972 |
actttacaaaatgaatgagaatagatgagattcattcatgctactaatggtgaaaatgagacaactcaatagcatcgtcctttccctttagtttgtacat |
12219071 |
T |
|
| Q |
211 |
ctaatggttagtgtccctacttgtttcaactccctatcacccctatcatcatactccaagtgtatagatgggtatattttgagatcaagttagttttttt |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
12219072 |
ctaatggttagtgtccctacttgtttcaaccccctatca--cctatcatcatactccaagtgtatagatggttatattttgagatcaagttagttttttt |
12219169 |
T |
|
| Q |
311 |
gtaat |
315 |
Q |
| |
|
||||| |
|
|
| T |
12219170 |
gtaat |
12219174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 377 - 432
Target Start/End: Original strand, 12219238 - 12219293
Alignment:
| Q |
377 |
ggtatgcggatcaaccattttaacatgtaggccaacacagaccgaattcagatcaa |
432 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
12219238 |
ggtatgcggatcaaccagtttaacatgtaggccaacacagaccgaactcagatcaa |
12219293 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University