View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14375_low_10 (Length: 369)
Name: NF14375_low_10
Description: NF14375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14375_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 28 - 352
Target Start/End: Complemental strand, 3129049 - 3128730
Alignment:
| Q |
28 |
cttcagaaatgcaagaaccaagcttagggatgatgcagggtggtggtggtgtttacggcggagatggtggcggtgagaacagacaactgaaggcggagat |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3129049 |
cttcagaaatgcaagaaccaagcttagggatgatgcagggtagtggtggtggttacggcggagatggtggcggtgagaacagacaactgaaggcggagat |
3128950 |
T |
 |
| Q |
128 |
agcaacacatcctttgtatgaacagcttctgtctgcacatgtagcatgtcttcgagttgctactcctatagatcagttaccattgattgatgctcagtta |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3128949 |
agcaacacatcctttgtatgaacagcttctgtctgcacatgtagcatgtcttcgagttgctactcctatagatcagttaccattgattgatgctcagtta |
3128850 |
T |
 |
| Q |
228 |
tctcaatctcatcatcttctacgatcttatatatctcaacaaactcattctctttcgcctcatgatcgtcaacaactcgacaacttcctcgtatgtctgt |
327 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3128849 |
tctcaatctcatcatcttctacgatcttatatctctcaacaaactcattctctttcgcctcatgatcgtcaacaactcgacaacttcctcgtatgt---- |
3128754 |
T |
 |
| Q |
328 |
actgtactatcatctttctatattc |
352 |
Q |
| |
|
|| ||||||||||||||||||||| |
|
|
| T |
3128753 |
-ctttactatcatctttctatattc |
3128730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University