View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14375_low_18 (Length: 241)
Name: NF14375_low_18
Description: NF14375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14375_low_18 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 4 - 241
Target Start/End: Original strand, 40293125 - 40293362
Alignment:
| Q |
4 |
gcagcagcagagaagcaagtaatgccgccaaaaacaaggaaaggctccatcaaagccaccttcacaacagtaagattaaacctaattcattcacacttaa |
103 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40293125 |
gcagcagcagcgaagcaagtaatgccgccaaaaacaaggaaaggctccatcaaagccaccttcacaacagtaagattaaacctaattcattcacacttaa |
40293224 |
T |
 |
| Q |
104 |
cttagatttcgtgtcacgcaagagagtctaatcgtcaaggttaagctattttcacnnnnnnnnnnnnnnnngggttttgcttcacaaacttaccctaata |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
40293225 |
cttagatttcgtgtcacgcaagagagtctaatcgtcaaggttaagctattttcacaaaataaaataaaaaagggttttgcttcacaaacttaccctaata |
40293324 |
T |
 |
| Q |
204 |
atatttgtgtttaggataactagaccatcgacccgtgc |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40293325 |
atatttgtgtttaggataactagaccatcgacccgtgc |
40293362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University