View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14375_low_6 (Length: 385)

Name: NF14375_low_6
Description: NF14375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14375_low_6
NF14375_low_6
[»] chr1 (3 HSPs)
chr1 (133-258)||(52162254-52162378)
chr1 (317-369)||(52162415-52162467)
chr1 (1-59)||(52162128-52162186)


Alignment Details
Target: chr1 (Bit Score: 92; Significance: 1e-44; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 133 - 258
Target Start/End: Original strand, 52162254 - 52162378
Alignment:
133 atggactttaaaacatttgtgaacattctttttaatatatgctaattttaaaacgnnnnnnnaagaagtaaaattaaaatcattcaagaaaaatgatacg 232  Q
    ||||||||||||||||||||||||||||||||| || ||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||    
52162254 atggactttaaaacatttgtgaacattctttttgatgtatgctaattttaaaacgtttttt-aagaagtaaaattaaaatcattcaagaaaaatgatacg 52162352  T
233 gaaacgactgactttcaagcacagga 258  Q
    ||||||||||||||||||||||||||    
52162353 gaaacgactgactttcaagcacagga 52162378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 317 - 369
Target Start/End: Original strand, 52162415 - 52162467
Alignment:
317 caatgtaatagttcatattcataaacaaaagtaaacatttcaaacaatggaat 369  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
52162415 caatgtaatagttcatattcataaacaaaagtaaacatttcaaacaatggaat 52162467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 52162128 - 52162186
Alignment:
1 atggtttggaatagggaaaattttctataaatatctatcaatctacttactattgttcc 59  Q
    |||||||| |||||||||  |||| ||||||||||||||||||||||||||||||||||    
52162128 atggtttgaaatagggaattttttttataaatatctatcaatctacttactattgttcc 52162186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University