View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14376_high_14 (Length: 504)
Name: NF14376_high_14
Description: NF14376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14376_high_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 8408061 - 8407822
Alignment:
| Q |
1 |
tactgacccgctgttatccttgtcaaagtattgaaaagccttgaacaaattctcttccctctcaagtttatgccggtttattgtggcagtaatgaattca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8408061 |
tactgacccgctgttatccttgtcaaagtattgaaaagccttgaacaaattctcttccctctcaagtttatgccggtttattgtggcagtaatgaattca |
8407962 |
T |
|
| Q |
101 |
tgatagtcaatagttccattcttgtcaacatcagcctgaccaaacatgtgaattaggaaagctatgtaagttcttattttatactttcttcatgaagaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8407961 |
tgatagtcaatagttccattcttgtcaacatcagcctgaccaaacatgtgaattaggaaaactatgtaagttcttattttatactttcttcatgaagaaa |
8407862 |
T |
|
| Q |
201 |
aaagaccagaaacactagtgtctgtttgatgtgagaaaat |
240 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
8407861 |
aaagatcagaaacactagtgtctgtttgatgtgagaaaat |
8407822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 116; E-Value: 8e-59
Query Start/End: Original strand, 370 - 485
Target Start/End: Complemental strand, 8407681 - 8407566
Alignment:
| Q |
370 |
gttgtctcaaatcaaacttgttcttaatttctaaaactgccggagactgaacttacagcatccattagctgctttatttcagattcactaagcttggatc |
469 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8407681 |
gttgtctcaaatcaaacttgttcttaatttctaaaactgccggagactgaacttacagcatccattagctgctttatttcagattcactaagcttggatc |
8407582 |
T |
|
| Q |
470 |
ccaatttggacagtcc |
485 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
8407581 |
ccaatttggacagtcc |
8407566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University