View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14376_high_59 (Length: 257)
Name: NF14376_high_59
Description: NF14376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14376_high_59 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 21 - 244
Target Start/End: Original strand, 3300882 - 3301105
Alignment:
| Q |
21 |
atgttctttttatgtttctagtttagtactagtagataagataaacaatggcagnnnnnnnnnnnngaggatcgtgttctcattccttgtgttacagtac |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
3300882 |
atgttctttttatgtttctagtttagtactagtagataagataaacaatggcagttttttgtttttgaggatcgtgttctcattccttgtgttacagtac |
3300981 |
T |
 |
| Q |
121 |
tatacaatacatcctcaacttctgtcaagagctacaacacttattgtttacattcnnnnnnnactatgtctttagcaagaacacgagaatatatggtatg |
220 |
Q |
| |
|
||||||||||||||||||||||||||| || |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3300982 |
tatacaatacatcctcaacttctgtcacgacctacaacacttattgtttacattctttttttactatgtctttagcaagaacacgagaatatatggtatg |
3301081 |
T |
 |
| Q |
221 |
gtataattttgctggataggagta |
244 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
3301082 |
gtataattttgctggataggagta |
3301105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University