View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14376_high_63 (Length: 247)
Name: NF14376_high_63
Description: NF14376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14376_high_63 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 19 - 234
Target Start/End: Original strand, 27119775 - 27119989
Alignment:
| Q |
19 |
attgtttgacaaaatataaaatgattgttttaggcaaaaatataaaataataattgactaccttttgggcaatagatatagctaattgtgtgacaatttg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27119775 |
attgtttgacaaaatataaaatgattgttttaggcaaaaatataaaataataattgactaccttttgggcaatagatatagctaattgtgtgacaatttg |
27119874 |
T |
 |
| Q |
119 |
ttacggttatagcatttgactttaatcaatattattgttgatgtttgattaagttttatgtttaggcaacagggttggtgcatgtattagtagttgattt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27119875 |
ttacggttatagcatttgactttaatcaata-tattgttgatgtttgattaagttttatgtttaggcaacagggttggtgcatgtattagtagttgattt |
27119973 |
T |
 |
| Q |
219 |
agttcaaatcttattt |
234 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
27119974 |
agttcaaatcttattt |
27119989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University