View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14376_high_64 (Length: 245)
Name: NF14376_high_64
Description: NF14376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14376_high_64 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 74 - 245
Target Start/End: Original strand, 32682847 - 32683018
Alignment:
| Q |
74 |
cctctgcagttgatcttccacatctcaaaaccgcaaatgcctctaccttgcttccaccgcttccctcctgtttgcagtgtgattgacgaactttctgcag |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32682847 |
cctctgcagttgatcttccacatctcaaaaccgcaaatgcctctaccttgcttccaacgcttccctcctgtttgcagtgtgattgacgaactttctgcag |
32682946 |
T |
 |
| Q |
174 |
atcccatggcaagttttttcatgaaatgttaacaaagtttatggggtctgaagcaatacttcttataaaaac |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32682947 |
atcccatggcaagttttttcatgaaatgttaacaaagtttatggggtctgaagcaatacttcttataaaaac |
32683018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University