View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14376_high_70 (Length: 229)

Name: NF14376_high_70
Description: NF14376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14376_high_70
NF14376_high_70
[»] chr7 (1 HSPs)
chr7 (19-215)||(26287747-26287943)


Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 19 - 215
Target Start/End: Complemental strand, 26287943 - 26287747
Alignment:
19 ggtggtgcgaggatcggcttgccatccgcaccaccttcgtgcatgttctttcggcggaggttcaggttgttcttggcgtactccgatctgtccggtttgt 118  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||    
26287943 ggtggtgcgaggatcggcttgccattcgcaccaccttcgtgcatgttctttcggcagaggttcaggttgttcttggcgtactccgatctgtccggttggt 26287844  T
119 gcgccggtggttcgacggatctccatctagttcgagttgttgaagctgttggaggttcttctggttcagtcgccgacgtcatcacggcagttctgtg 215  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||| ||||||||||||||||||||||||||||| |||| ||||    
26287843 gcgccggtggttcgacggatctccatctagttcgagttgctgaagctattggaggtttttctggttcagtcgccgacgtcatcacggtagttatgtg 26287747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University