View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14376_high_72 (Length: 225)

Name: NF14376_high_72
Description: NF14376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14376_high_72
NF14376_high_72
[»] chr4 (1 HSPs)
chr4 (14-209)||(37834759-37834954)


Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 14 - 209
Target Start/End: Complemental strand, 37834954 - 37834759
Alignment:
14 aggggtgagttggtttgatgaaaacttaaggaaggtgattggagatgggaaaggcacgaatttttggatggagcgatggagacaacttgcgtcatctctt 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37834954 aggggtgagttggtttgatgaaaacttaaggaaggtgattggagatgggaaaggcacgaatttttggatggagcgatggagacaacttgcgtcatctctt 37834855  T
114 tagtagagtttatgatatatcgcttgataaagataaatgcctagcagatatgattgttgaaggagttggagaagaaggttgtttcaacgggaggag 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37834854 tagtagagtttatgatatatcgcttgataaagataaatgcctagcagatatgattgttgaaggagttggagaagaaggttgtttcaacgggaggag 37834759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University