View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14376_low_35 (Length: 366)
Name: NF14376_low_35
Description: NF14376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14376_low_35 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 64; Significance: 7e-28; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 24 - 176
Target Start/End: Original strand, 25771483 - 25771632
Alignment:
| Q |
24 |
tgatcttccatcttgcatcaacacattagcaacgagttcgatgatctagagcagcgacaaatatcttgtccaaagagcnnnnnnnngaatttagcgaaaa |
123 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| |||||| || ||||| |||||| |||||||| |||| |
|
|
| T |
25771483 |
tgatcatccatcttgcatcaacacattagcaacgagttcaatgatctagagcagcaacaaatttc-tgtcc-aagagc-aaaaaaagaatttagttaaaa |
25771579 |
T |
|
| Q |
124 |
tttagacagaagagctaagaacacagtatttgcattgcaaaacttgaatttaa |
176 |
Q |
| |
|
|| ||| |||||||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
25771580 |
ttgagaaagaagagcagagaacacggtatttgcattgcaaaacttgaatttaa |
25771632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 231 - 315
Target Start/End: Original strand, 25771647 - 25771732
Alignment:
| Q |
231 |
ctcaatcacatgattgtgtctta-caattccgatagcaaagtcaattaacttttctaaatggatgacagttcttgactttttcatt |
315 |
Q |
| |
|
||||||||||||| |||||||| ||||||| |||| ||| |||||||| | ||||||||||| ||||||||||||||||| |||| |
|
|
| T |
25771647 |
ctcaatcacatgaatgtgtcttctcaattccaatagaaaactcaattaattattctaaatggacgacagttcttgacttttacatt |
25771732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 174 - 248
Target Start/End: Complemental strand, 45301628 - 45301552
Alignment:
| Q |
174 |
taatctggcctc--atatgtcttgctgtttgtttttcatgttctctttgatattattgtctcaatcacatgattgtg |
248 |
Q |
| |
|
|||||||||||| |||||| ||||| |||||| ||||||| | ||| |||||||| |||||||| |||||| |||| |
|
|
| T |
45301628 |
taatctggcctcatatatgtattgctatttgttattcatgtccgcttcgatattatggtctcaattacatgaatgtg |
45301552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University