View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14376_low_40 (Length: 348)
Name: NF14376_low_40
Description: NF14376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14376_low_40 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 7e-74; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 7e-74
Query Start/End: Original strand, 19 - 212
Target Start/End: Complemental strand, 47893616 - 47893422
Alignment:
| Q |
19 |
ggtttcggatggattaaggaatggtgtatgagtgagtgagaggagtaattgattgcagtgtgactcgtgtagctagctagctatatatagaaagaaatga |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
47893616 |
ggtttcggatggattaaggaatggtgtatgagtgactgagaggagtaattgattgcagtgtgactcgtgtagcta----gctatatatagaaagaaatga |
47893521 |
T |
 |
| Q |
119 |
atatca--atg---ctatgcatgtggtttgaaaaatttaactgtggtttgagtaagtctacttggcttgctttataatggtaattattggcttctacct |
212 |
Q |
| |
|
||| | ||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47893520 |
ataatatcatgtgcctatgtatgtggtttgaaaaatttaactgtggtttgagtaagtctacttggcttgctttataatggtaattattggcttctacct |
47893422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 121; E-Value: 6e-62
Query Start/End: Original strand, 211 - 331
Target Start/End: Complemental strand, 47893378 - 47893258
Alignment:
| Q |
211 |
ctaaaaatgcaaatgccaaacttatcaatatatatgcaaatcttgtaaacttctcctaaatatccaatttgtcgactttgttttgatggaattgataaac |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47893378 |
ctaaaaatgcaaatgccaaacttatcaatatatatgcaaatcttgtaaacttctcctaaatatccaatttgtcgactttgttttgatggaattgataaac |
47893279 |
T |
 |
| Q |
311 |
caccctccattttgtcttcat |
331 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
47893278 |
caccctccattttgtcttcat |
47893258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University