View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14376_low_59 (Length: 280)
Name: NF14376_low_59
Description: NF14376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14376_low_59 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 265
Target Start/End: Original strand, 7450603 - 7450879
Alignment:
| Q |
1 |
tacggaatgaattattatcacttaccagtgtcaatttattaagggactaaa------------tcaagtagcaagaatctttgattattctatacaagcc |
88 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7450603 |
tacggaatgaattattatcacttaccagtgtcaatttattaagggactaaaaaattaattaaatcaagtagcaagaatctttgattattctatacaagcc |
7450702 |
T |
 |
| Q |
89 |
tctcgaagatactgacttagctgtggagatttgttgcttttatatgggcaataattaattcaaccttttgatgaaagggactagcttaggctttgtcttc |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7450703 |
tctcgaagatactgacttagctgtggagatttgttgcttttatatggggaataattaattcaaccttttgatgaaagggactagcttaggctttgtcttc |
7450802 |
T |
 |
| Q |
189 |
caatggaaagctcgtctcttttcttgatggctttttcttcacattatttttccaactagctactagtacttgtgtat |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7450803 |
caatggaaagctcgtctcttttcttgatggctttttcttcacattatttttccaactagctactagtacttgtgtat |
7450879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 154 - 193
Target Start/End: Original strand, 7436755 - 7436794
Alignment:
| Q |
154 |
ttttgatgaaagggactagcttaggctttgtcttccaatg |
193 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7436755 |
tttttatgaaagggactagctttggctttgtcttccaatg |
7436794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University