View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14376_low_60 (Length: 279)
Name: NF14376_low_60
Description: NF14376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14376_low_60 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 1 - 269
Target Start/End: Complemental strand, 30817177 - 30816909
Alignment:
| Q |
1 |
ttgatgatattaggcctgtgcttcatgccgtgcaatttgagctggctaatgttaagacggcgatggggaggagagaagaggcgcttgagaatcttcggaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30817177 |
ttgatgatattaggcctgtgcttcatgctgtgcaatttgagctggctaatgttaagacggcgatggggaggagagaagaggcgcttgagaatcttcggaa |
30817078 |
T |
 |
| Q |
101 |
gtgtttggagattaaggagatgacttttgacgaagatagtgaggagttggggaaagggaatagggatttagcggaagcgtttgttgcagttttgaatttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30817077 |
gtgtttggagattaaggagatgacttttgacgaagatagtgaggagttggggaaagggaatagggatttagcggaagcatttgttgcagttttgaatttt |
30816978 |
T |
 |
| Q |
201 |
aaggaggcacttccgtattgtttgaaggcgttggagatacatacgaaacgattagggatgaattctgtg |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30816977 |
aaggaggcacttccgtattgtttgaaggcgttggagatacatatgaaacgattagggatgaattctgtg |
30816909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University