View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14376_low_67 (Length: 248)
Name: NF14376_low_67
Description: NF14376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14376_low_67 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 13 - 248
Target Start/End: Complemental strand, 27312764 - 27312529
Alignment:
| Q |
13 |
catcatctgctttcgaactttatcgggtaatctcaatgtaaacctctcacaatcctcacctggttgcaccaacacacctgttgagtttgaccgtgataac |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27312764 |
catcatctgctttcgaactttatcgggtaacctcagtgtaaacctctcacaatcctcacctggttgcaccaacacacctgttgagtttgaccgtgataac |
27312665 |
T |
 |
| Q |
113 |
aagagaatagataagaatcctgttgatcttgaccgtgttggtgcagaatatgttttagacctatgaagtacatctaccttaggtgaattttccacttcca |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
27312664 |
aagagaatagataagaatcctgttgatcttgaccgtgttggtgcagaatatgttttagacctacgaagtacatctaccttaggtgaattttccacttcca |
27312565 |
T |
 |
| Q |
213 |
cgttggctttcttttgttcctcttcaacaatatgtt |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
27312564 |
cgttggctttcttttgttcctcttcaacaatatgtt |
27312529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University