View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14376_low_72 (Length: 236)
Name: NF14376_low_72
Description: NF14376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14376_low_72 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 16 - 170
Target Start/End: Complemental strand, 2243893 - 2243739
Alignment:
| Q |
16 |
attattctaaacagtggcctttttgtttaaacttggtgttacttatttcctttctttgttccgtgtgtcaggttagaaaaggataggaattataactact |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2243893 |
attattctaaacagtggcctttttgtttaaacttggtgttacttatttcctttctttgttccgtgtgtcaggttagaaaaggataggaattataactact |
2243794 |
T |
 |
| Q |
116 |
ttttggtgcgctgtttaaaactgttatgtgtaagtactttctaattatacagtga |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2243793 |
ttttggtgcgctgtttaaaactgttatgtgtaagtactttctaattatacagtga |
2243739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 187 - 215
Target Start/End: Complemental strand, 2243722 - 2243694
Alignment:
| Q |
187 |
gcaaagttatggcttataatatactacct |
215 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2243722 |
gcaaagttatggcttataatatactacct |
2243694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University