View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14376_low_75 (Length: 229)
Name: NF14376_low_75
Description: NF14376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14376_low_75 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 19 - 215
Target Start/End: Complemental strand, 26287943 - 26287747
Alignment:
| Q |
19 |
ggtggtgcgaggatcggcttgccatccgcaccaccttcgtgcatgttctttcggcggaggttcaggttgttcttggcgtactccgatctgtccggtttgt |
118 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
26287943 |
ggtggtgcgaggatcggcttgccattcgcaccaccttcgtgcatgttctttcggcagaggttcaggttgttcttggcgtactccgatctgtccggttggt |
26287844 |
T |
 |
| Q |
119 |
gcgccggtggttcgacggatctccatctagttcgagttgttgaagctgttggaggttcttctggttcagtcgccgacgtcatcacggcagttctgtg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||| ||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
26287843 |
gcgccggtggttcgacggatctccatctagttcgagttgctgaagctattggaggtttttctggttcagtcgccgacgtcatcacggtagttatgtg |
26287747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University