View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14376_low_77 (Length: 225)
Name: NF14376_low_77
Description: NF14376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14376_low_77 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 14 - 209
Target Start/End: Complemental strand, 37834954 - 37834759
Alignment:
| Q |
14 |
aggggtgagttggtttgatgaaaacttaaggaaggtgattggagatgggaaaggcacgaatttttggatggagcgatggagacaacttgcgtcatctctt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37834954 |
aggggtgagttggtttgatgaaaacttaaggaaggtgattggagatgggaaaggcacgaatttttggatggagcgatggagacaacttgcgtcatctctt |
37834855 |
T |
|
| Q |
114 |
tagtagagtttatgatatatcgcttgataaagataaatgcctagcagatatgattgttgaaggagttggagaagaaggttgtttcaacgggaggag |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37834854 |
tagtagagtttatgatatatcgcttgataaagataaatgcctagcagatatgattgttgaaggagttggagaagaaggttgtttcaacgggaggag |
37834759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University