View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14376_low_78 (Length: 221)
Name: NF14376_low_78
Description: NF14376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14376_low_78 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 88 - 207
Target Start/End: Original strand, 26292283 - 26292402
Alignment:
| Q |
88 |
cttcctccccaatcacgtcctcctccgtcttcattcagccgaaattctcctccgacacagtcacattactctcacttctcatcaatcccaccttccgcta |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26292283 |
cttcctccccaatcacgtcctcctccgtcttcattcagccgaaatcctcctccgacacagtcacattactctcacttctcatcaatcccaccttccgcta |
26292382 |
T |
 |
| Q |
188 |
atccttcacaggcttcatct |
207 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
26292383 |
atccttcacaggcttcatct |
26292402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University