View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14376_low_78 (Length: 221)

Name: NF14376_low_78
Description: NF14376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14376_low_78
NF14376_low_78
[»] chr1 (1 HSPs)
chr1 (88-207)||(26292283-26292402)


Alignment Details
Target: chr1 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 88 - 207
Target Start/End: Original strand, 26292283 - 26292402
Alignment:
88 cttcctccccaatcacgtcctcctccgtcttcattcagccgaaattctcctccgacacagtcacattactctcacttctcatcaatcccaccttccgcta 187  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26292283 cttcctccccaatcacgtcctcctccgtcttcattcagccgaaatcctcctccgacacagtcacattactctcacttctcatcaatcccaccttccgcta 26292382  T
188 atccttcacaggcttcatct 207  Q
    ||||||||||||||||||||    
26292383 atccttcacaggcttcatct 26292402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University