View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14376_low_80 (Length: 216)
Name: NF14376_low_80
Description: NF14376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14376_low_80 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 19 - 199
Target Start/End: Complemental strand, 37215111 - 37214931
Alignment:
| Q |
19 |
agagccaaatcattgctttaaatannnnnnncttacctgagccgcgaaatcgttggagtcggaatcaggtgaagaacttgtatccagccttttgattgca |
118 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37215111 |
agagccaaatcattgctttaaataattttttcttacctgagccgcgaaatcgttggagtcggaatcaggtgaagaacttgtatccagccttttgattgca |
37215012 |
T |
 |
| Q |
119 |
gcttcagtaccatcattcatttttgcatagtaaacccttccatacgaaccttcaccaatgaaggcctttgaaccaaagttt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37215011 |
gcttcagtaccatcattcatttttgcatagtaaacccttccatacgaaccttcaccaatgaaggcctttgaaccaaagttt |
37214931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 141 - 198
Target Start/End: Complemental strand, 52717148 - 52717091
Alignment:
| Q |
141 |
ttgcatagtaaacccttccatacgaaccttcaccaatgaaggcctttgaaccaaagtt |
198 |
Q |
| |
|
||||||| || ||||| |||||||| ||||||||||| || |||||||| |||||||| |
|
|
| T |
52717148 |
ttgcataatacaccctcccatacgacccttcaccaatcaatgcctttgatccaaagtt |
52717091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University