View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14376_low_81 (Length: 214)
Name: NF14376_low_81
Description: NF14376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14376_low_81 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 18 - 186
Target Start/End: Original strand, 12552975 - 12553143
Alignment:
| Q |
18 |
atgaattccatatggatcataagggcttacgaattgcattttttaaaattctgttaaagttctatagatagtgccattaaataaattggtagatttccca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
12552975 |
atgaattccatatggatcataagggcttacgaattgcattttttaaaattctgttaaagttctatagatagtgccattaaataaattggtagattgccca |
12553074 |
T |
 |
| Q |
118 |
ttgttttattgtgaaagaggaagaaaaatagttgtttccttctaagacacatcatgggtacgtaagtgt |
186 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
12553075 |
ttgttttattgtgaaagaggaagaaatatagttgtttccttctaagacacatcatgggtacgtatgtgt |
12553143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University