View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14376_low_82 (Length: 210)

Name: NF14376_low_82
Description: NF14376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14376_low_82
NF14376_low_82
[»] chr6 (2 HSPs)
chr6 (1-195)||(888053-888247)
chr6 (71-195)||(1002916-1003034)
[»] scaffold0117 (1 HSPs)
scaffold0117 (1-53)||(16562-16616)
[»] chr4 (1 HSPs)
chr4 (1-44)||(48301349-48301392)


Alignment Details
Target: chr6 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 195
Target Start/End: Complemental strand, 888247 - 888053
Alignment:
1 ctataactataagcagaatgcacagagaaaattagttaagatagtcgtaacataaatttggagtatcttctcacaatatatgcgtgtcatatcttgattc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
888247 ctataactataagcagaatgcacagagaaaattagttaagatagtcgtaacataaatttggagtatcttctcacaatatatgcgtgtcatatcttgattc 888148  T
101 gatatccaaaatcgatgcacacattgtaaatcaaatggttatgttattttggatacgagtctcattttgaatcttgattccttttgatgattcat 195  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
888147 gatatccaaaatcgatgcacacattgtaaatcaaatggttatgttattttggatacgagtctcattttgaatcttgattccttttgatgattcat 888053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 71 - 195
Target Start/End: Original strand, 1002916 - 1003034
Alignment:
71 tcacaatatatgcgtgtcatatcttgattcgatatccaaaatcgatgcacacattgtaaatcaaatggttatgttattttggatacgagtctcattttga 170  Q
    |||| ||||||| | ||| || ||||||||||||| ||||||||||  ||||||| ||||| |||||||| ||||||    |||| || | |||||||||    
1002916 tcacgatatatgtgagtcgtaacttgattcgatattcaaaatcgat--acacattttaaatgaaatggttttgttat----gatatgaatatcattttga 1003009  T
171 atcttgattccttttgatgattcat 195  Q
    ||||||||||||||| |||| ||||    
1003010 atcttgattccttttaatgaatcat 1003034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0117 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0117
Description:

Target: scaffold0117; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 16562 - 16616
Alignment:
1 ctataactataagcagaatgcac--agagaaaattagttaagatagtcgtaacat 53  Q
    |||||||||||||||||||||||  ||||||| ||| ||||||||||| ||||||    
16562 ctataactataagcagaatgcacatagagaaagttacttaagatagtcataacat 16616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 48301349 - 48301392
Alignment:
1 ctataactataagcagaatgcacagagaaaattagttaagatag 44  Q
    |||| |||||||||||| ||| ||||||||||||||||||||||    
48301349 ctatgactataagcagactgcgcagagaaaattagttaagatag 48301392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University