View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14376_low_84 (Length: 203)
Name: NF14376_low_84
Description: NF14376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14376_low_84 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 42 - 180
Target Start/End: Complemental strand, 42293123 - 42292985
Alignment:
| Q |
42 |
ctttggtaatgtttaggaaaagaataaaagtattacttaccttgtggctcggccttcacgtttgcctccatccccaatggtaatatgcactggaccacaa |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42293123 |
ctttggtaatgtttaggaaaagaataaaagtattaattaccttgtggctaggccttcacgattgcctccatccccaatggtaatatgcactggaccacaa |
42293024 |
T |
 |
| Q |
142 |
ttgtcacctttatctttataaacccgtgtctaagaaaat |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42293023 |
ttgtcacctttatctttataaacccgtgtctaagaaaat |
42292985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University