View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14377_low_4 (Length: 337)
Name: NF14377_low_4
Description: NF14377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14377_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 71; Significance: 4e-32; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 12 - 86
Target Start/End: Original strand, 12884272 - 12884346
Alignment:
| Q |
12 |
gaagaatattgtgttgctggaggaacctgcgggtgggaattggttcaatatgaaggttgttatgggggtagtaaa |
86 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
12884272 |
gaagaatattgtgttgctggaggaacctgcgggtgggaattggttcaatatgaaggttgttatgagggtagtaaa |
12884346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 122 - 208
Target Start/End: Original strand, 12884447 - 12884533
Alignment:
| Q |
122 |
tgggtgggtgataaccctcttcgtgttaggttccctagaatgaattcactttcaaaccaaaaggaaggcttctttaacgaaatggaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| ||||||||||| |||||||| ||||| || |||||||||||||| |
|
|
| T |
12884447 |
tgggtgggtgataaccctcttcgtgttaggttccctcaaatttattcactttcagaccaaaagaaaggcctcattaacgaaatggaa |
12884533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University