View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14378_high_10 (Length: 214)
Name: NF14378_high_10
Description: NF14378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14378_high_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 75 - 200
Target Start/End: Complemental strand, 52372367 - 52372245
Alignment:
| Q |
75 |
ctacaagcaaatttatggggcactccccgttacaagcaaatttatgagccatatttaagattgataataaggtttcaaaaatggccaacgtgtttgttta |
174 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
52372367 |
ctacaagcaaatttatggggcattccccgttacaagcaaatttatgagccatatttaagattg---ataaggtttcataaatggccaacgtgtttgttta |
52372271 |
T |
|
| Q |
175 |
tgaagcacaagtgtgtatctgtctcc |
200 |
Q |
| |
|
||| |||||||||||||||||||||| |
|
|
| T |
52372270 |
tgatgcacaagtgtgtatctgtctcc |
52372245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University