View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14378_high_6 (Length: 273)
Name: NF14378_high_6
Description: NF14378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14378_high_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 19 - 264
Target Start/End: Complemental strand, 27448631 - 27448387
Alignment:
| Q |
19 |
ttccttgtattggaaaaatacatgaactattagtagacttcacaaaagctgaaccaaggttaatcgggttgctattaatttgcagttgggaagagatctt |
118 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27448631 |
ttccttgtattggaaaa-tacatgaactattagtagacttcacaaaagctgaaccaaggttaatcgggttgctattaatttgcagttgggaagagatctt |
27448533 |
T |
|
| Q |
119 |
gaattaacaaaaatgtcgaagcatctgcctttcatcttattaaaataaatcgtactagacttgcagaaccttggtatttgcaacaaatcttactgctcca |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
27448532 |
gaattaacaaaaatgtcgaagcatctgcctttcatcttattaaaacaaatcgtactagacttgcagaaccttggtatttgcaacaaatcattctgctcca |
27448433 |
T |
|
| Q |
219 |
cacatgatagcatgtaagttgcactagcccatattaccatattctt |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27448432 |
cacatgatagcatgtaagttgcactagcccatattaccattttctt |
27448387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University