View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14378_low_10 (Length: 267)
Name: NF14378_low_10
Description: NF14378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14378_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 12 - 251
Target Start/End: Original strand, 4320472 - 4320711
Alignment:
| Q |
12 |
cacagatccaaaatcggttcatctcaacacagatctgaacttcaatatatcaccacagttatgaaaccaagcttaaacatgtactgaagctgtttcgttc |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4320472 |
cacagatccaaaatcggttcatctcaacacatgtctgaacttcaatatatcaccacagttatgaaaccaagcttaaacatgtactgaagctgtttcgttc |
4320571 |
T |
|
| Q |
112 |
tcaacaaactggcatacaactgaaagcaagatcgaaatccagagaaagaaggaagaatgtccagatcggagcttatccgaaccagatcgagctctctttg |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4320572 |
tcaacaaactggcatacaactgaaagcaagatcgaaatccagagaaagaaggaagaatgtccatatcggagcttatccgaaccagatcgagctctctttg |
4320671 |
T |
|
| Q |
212 |
ttttgaagttttccgtttgtgctagctttctccgaatata |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4320672 |
ttttgaagttttccgtttgtgctagctttctccgaatata |
4320711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University