View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14379_high_17 (Length: 248)
Name: NF14379_high_17
Description: NF14379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14379_high_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 4681616 - 4681390
Alignment:
| Q |
1 |
cccgtgtatgtgtgaatgggaatgacactaatacca---accaacctatactatacaatactataattttgagagcatttacgaggcagcagcagcccaa |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4681616 |
cccgtgtatgtgtgaatgggaatgacactaataccaccaaccaacctatactatactatactataattttgagagcatttacgaggcagcagcagcccaa |
4681517 |
T |
|
| Q |
98 |
tgacgtcaat------aaaaaatcgagtataataataataat---accacgcatattgaa--atcaaaacgagaggaccaaacataaacactccctctct |
186 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||| |||||||||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4681516 |
tgacgtcaataaaataaaaaaatggagtataataataataataacaccacgcatactgaaatatcaaaacgagaggaccaaacataaacactccctctct |
4681417 |
T |
|
| Q |
187 |
tcttcccattggtgtttcatctcactc |
213 |
Q |
| |
|
|||||||||||||||||||| |||||| |
|
|
| T |
4681416 |
tcttcccattggtgtttcatttcactc |
4681390 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University