View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14379_high_17 (Length: 248)

Name: NF14379_high_17
Description: NF14379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14379_high_17
NF14379_high_17
[»] chr4 (1 HSPs)
chr4 (1-213)||(4681390-4681616)


Alignment Details
Target: chr4 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 4681616 - 4681390
Alignment:
1 cccgtgtatgtgtgaatgggaatgacactaatacca---accaacctatactatacaatactataattttgagagcatttacgaggcagcagcagcccaa 97  Q
    ||||||||||||||||||||||||||||||||||||   ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
4681616 cccgtgtatgtgtgaatgggaatgacactaataccaccaaccaacctatactatactatactataattttgagagcatttacgaggcagcagcagcccaa 4681517  T
98 tgacgtcaat------aaaaaatcgagtataataataataat---accacgcatattgaa--atcaaaacgagaggaccaaacataaacactccctctct 186  Q
    ||||||||||      ||||||| ||||||||||||||||||   |||||||||| ||||  ||||||||||||||||||||||||||||||||||||||    
4681516 tgacgtcaataaaataaaaaaatggagtataataataataataacaccacgcatactgaaatatcaaaacgagaggaccaaacataaacactccctctct 4681417  T
187 tcttcccattggtgtttcatctcactc 213  Q
    |||||||||||||||||||| ||||||    
4681416 tcttcccattggtgtttcatttcactc 4681390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University